Tupaia_belangeri Locus Mono:57:SNORA38
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:57:SNORA38
Tupaia_belangeri
Mono:57:SNORA38
scaffold_149238
SNORA38
1001..1135
2135
GCCTTTCCTTGATTTTGACCTCTCTCACTATAATGTTCCTTGAGGAAGGATCTTTAAAT
ATTGATTGTATTTGTCATCCTCTGTATTTCCTGTGTCTGGATGTTTGGATGTCTCTCTAG
GTTTGGGAAGTTTTCTGCAAATATTTCATGGAATGGATTTTCTATGCCTTTTTCAAATTC
TTCCAGCGTCTGTATGCAACGAGTGGCTCTTCGGAAAAAGCAAAGCTGAGACATTCTTGC
TGCCGCCTGTGGGTCCTCTATCGGCCTTTTCAAAATCAAACCAACCTTGGCCAGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTTGATCTTTAA
TGTATCTATATTCCTGTTGTGTCTCATTTTTGTTTTGTTTTGTATTTTTCATCATTTGGT
AGGTTTGTCTAAATCAGATACTTTGTCTTTTAGATCAGAGAGCCTATCTTTTGCATGGCC
TAATTTGCTATTAATACTATTGGGGGAGGATTCAGTTTCTTGTAGTAGAGTCTTCATCTC
TAGAAGTTCTGTTTGATTCTTTTTTGTTTGTTTGTTTTGGTGTCTATCTTTTTATCTTCA
AGTCATGGAATGATTTTTTTTTTAATCTTCTGAAGTTGGTTGTCTTTTTCTCTTGCATCT
CATTAGGTTTAGTTACCACTCCGGACACGTAAGAATTGGAGGCAAAGAAATGTGGATTTG
GAGGAATCTGGAGCCTGCTTGCTCCCTGTAGGCTCAAGATCACCCATCCCATATAGAAGC
ATTTATTAAATTAAGTCTTGCCTGTAGAAATTTCAGAAATTATCAAGGGCAGGGAGAGGG
GTGGCTTGTAAGAGGAGTTTGGACTAAGTGGGCACTATGACATTGAAGACATCTAAATGG
TATCTAGGGTGGGAGGATGTCAGATTTCCCATGTGAGGCATTTTTGACCCTCAAAAACAA
AACAAAACAAAACAAAACCAAAAAAAGTTTAGTTACCATAAATACTCTAAATTCTTTTTC
TGACATTTCAGTGATTTCCTCCTTATTTTTTTTTCACAGTTGGAGATGAGTTATTGTGTT
TCCTTGTTGGGGAACTATTTCCTGGTTTTTTCAGAGTTGAAGCTCTTCTATGATTTTTAG
TCATTCAGTGATCTTTTCACTTCTTGATAATTCTTTGGAGTACGTTTCTTTTTTTTCTTT
TCTTTCTTTTTTTTTTTTTTTTTGAGAGGTTTTTGCTATAGGGTGCACGCCACAATTCCT
TCTCCTCCATTCTCTCAGGATCATGGTCACGCACGCACATGTGCCCGGCTAGAGTTTAAG
CCACCAGGGCGGACCTCGAGCTGTGGTTGATTACATGGGCGTCCAGCAACATAGCCATTA
CGCTAACTGCTGGTCCTTGGTAGGTTTCTTGTAGCTGTGTGATCACGAATGCTTCCCTTT
GTTGTGAATTAGCTCTGTGCCAATTTCTATGGTTTGCAATGTGGTATCCACAGCAGGCGT
CTTGGGTTCATATTTACAAAGAAGAGTTTCTTTTAACTGGTGGGTTCAGCATAGGGAGAG
AATTCCTCCAGAGCCTCACAGTGTTTAGATGGTTGTCTCCAAATATACTTATATCTCTCT
AGTCCTTGTGCAGATGGAGGCTGAGAAGCAAAGTGATAATATAAGGTGGTAAAAAAAATA
ATTGTGTGCTGCACTATGGCAGGCAAACCCAATCAATGGGACTCTCAACTGGATAGAAGG
CTTCAGATGGAGAATGTCTGTTTAAAAGACCTACTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved