Tupaia_belangeri Locus Mono:143:SNORA26
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:143:SNORA26
Tupaia_belangeri
Mono:143:SNORA26
GeneScaffold_579
SNORA26
1001..1121
2121
CTGACATTAGTCAGCTCTTTCAGGGCTCCTCGTTCCTATCATCCACACCAGTTCATATC
CGCCAGGGACCAGCGCAGTAAAGGTTACCACTTCAAACAGGAAAATAGTCTATTTCTTTA
ATTAAAGAAAAATCCTCATTACAGTCTGATTTTTCTTTTAAATAGCATAAAGGTAAACAT
CAATTCAGCCTACAGAAATATTTCAAATTAATGTAGACTAATGTGAATCTAGCTCCTTAT
GACTTCTCACAATTCAGATCAGTTGGTACACATCTGAGTACCCTTTTCAAGGTTACAATT
TGCAGAATTGCAATAGGGCAGATTTTCATTGCTGTTACTCTAAATTTTCTGATTATCCAA
AAATAGATTTTTGTGGTTATAGAATAAAAAGTGGAACAGAGTGGTAGGTTATTTATTTTT
CTTATGATCTAATCTCTGCATGTTACATATTATTGCTTTTTTGGTAGTGTTCTTGCTTTT
GTTTTTGTGTTTTTGTGTTTCCTTTTTTTTTTTTTTTTTTTTTTTTTGAGAGAGAGATTT
TTGCTATAGAGCACATGTGCTCACCAGAGAGACAGAGAAAGACAGAGCGACAGAAAGCGA
GAAGTCACTCCCCCCAGGGGGTATGGACATGTTGTAATCCCTTCTCCTCCGTTCTCCTCT
TGGGATCTTGGGCATGCATGCACATGCACCTGGCATGAGGTTTAAGGCACTGGATCCAGG
ACCTGAACCACAGTGGACTCTGTAGGAGTCCAGTGACATAAACATTACACCATTTGCTGG
TCCCTTGCTTCTGGTATTTTAAACTATCTTTTAACCATTCAGTTAATGTTATATATTACA
CAGATGTCTGAAATTATTTGAGTGTGGTGTTCAGAGAAACCTAAATAGAACTAGTTTTAA
AAATCATTATTTTTTTGGTTTTCCAAAACTTGATAAAATGACTTCTCCACCTTTATTTAT
TTTTTTACTTCCATAATAATGTTCTTGATTCGCCCTTTCCTGTGCCCTTTTAAGGCTGCC
GCAGTGCTTTAAGAGGCTAACACAGAAGGGTAAAGTAAGTCTCCATAAAACCCAGAGAAG
AGATGATCAACTCCTCTTTGGATCCTGTCTGGAGTCACAGCTGAAAAAGAAAAAAATAAG
AATGTTCTTGATTTCATTTTTTGAGGTCGATATGTTGCCTCCTATCTATATTAAATTCAC
TGGAGCAAGGCCCTAAGTACATTTGTCAAACGTCCAATTTGGTGATAACCAAGTTAACGA
GTAACATTTGTTATTAATTACATCAGTGAAAACATCATAATCTTACAACTCTAGCTTGAG
CCTAATAGAGGAGGAGGTTTGAGGGATGAATATTCACAAGCAATTAATAGACCACTCTTT
AGAAAAAAAATGCTAAAAATCATTTTAATAGCCTCTTTGCATTCTAACCAGACTTCAGCA
ATTCAAACCATATCTAGCTAGGAAAAAAAATGTAATTGAGTCCTTAAAATTAAATCCAAT
GAACTTGTCTTTGCAGAAGGTCAAGTAATATACTCTCATGAAAGAAAACTCTTCTTCATT
TAATGCATCAGTTATTAAAAAGGTGTTCTTTTTTCCTGTTTGGGTTCTGTCTCTCTTTTT
TTATTACTGCATATTAAAGTAACTGTCTTGCCAACATGCAAATGATATGCTAACTGAACA
TGGCTAGGATGAAAGTGATGATGAAAGGGCCAAAGAGACCTATCAGCTACATTATTATGG
CTAAACAACAGAAAATCACTGAGCTTCCAGAATCTTCCTCTATTCCTTGCTTACACAACT
CAGAAACAAGTGAAAGTTAAAACATAGTAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved