Tupaia_belangeri Locus Poly:15:SNORD88
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:15:SNORD88
Tupaia_belangeri
Poly:15:SNORD88
GeneScaffold_2859
SNORD88, SNORD88
1001..1092, 3575..3664
4664
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGG
TTGCAGCGTGTGTCTTACTTGGTTCATTCATGCTTAGTGTTTTGTGAGCAAATTTCATGT
TTTACCAAAAACAGTTAACACGTACCTAAAATAACATTTCTATTTAATGAAAAGGCTGTT
GTCACCTTTAATGAGGCTGATTACTTAGTGCTGCCATCTGCTTGATGTTTTTTGTTTCCA
TTCACCTCCAGAATCTTGCACCGCGAACTCTAAGGCATCTGGTTCAGTGAAAGGGTCTGG
TGGTCGATGCTTACATCTCGGCCTCTGTTCCTGGAGTAGCCCCTTCCTTCTCATTCCCCC
TTCGTGTAAGGGCTTTCTTTGCGTGTGATTAGCTTCCACCGTCTAGGGTTACTAGGAAGT
GTAGCCAGGACCAAAAATGCAAAACTAGGCAGGAGTGGGAGGAGACACTGGGGTCCTTTT
CATGGAGAGGGGCATGGTCTGTCCCATGAGGTCAGACCTCTGTGGACCTAGGACATGGGG
AGGTTGTGGCATTCTGGGAGGTGGTTGGTTTCCCAGTCTAAGCTGTTAGCTAGGCCTGTC
CCTGAAGGTAAGTGGCTTTGGTTCTGATTGCAGAGTGGTCAGGGCTCCCGTGATGTCCAG
CACTGGGCTCCAATTAGCCATGAGGACACAGTGCTCCCCCAGGACCTTTGACACCTGGGG
GTCTGAGGGGCCCCGGTTTTGATGTCCTCAGCCTGTGGAGTATAGCTCTCCACCCTTACC
AGTCTTCTCTGTTACAGGAGTATCTTCAAGCTGAGGGGCTGCCCACCACCATCCTGTCTG
GTAAGAACCCTTCTTCCCACTCGCTGATCTACCCGGACCTAACATATCCCAGCCTGACCT
TGGGTGGCTTCATATCAGATTTCTCTCGGACCTCGTCATGTGCCAGCCCTGGTACTCAGG
ATTCACACTGAAAGCCATCTCATAGCCGTGGAAACCCAGTTGGGCACAGTCTGGGTGCCC
ACTAGCAGGAGTGCACACCTGAGTCCTGTGCAGACGGGTGGGCTGGTCATCTTCGCCTCC
CAGATGGAGGGTAGAGAAGATGAGGAAAGCACAGACTGGAAGGAAAAGGTTTGCAGCTTC
AGGAAGGAATCAGAAACATAATTTTCAAGCTCAGCAGTGGAAGAGAAGAGAATGACTCTC
CATGTAATCTCCCTAGACACGGCTCACGCTGAGAACAGGGTACTTTTAGCATGGTTTGGT
CAGGGCCCAGTGTGCCGTTTACATGTCAGCTGATAGTAAAGAGACTTTAGTTTACATCAT
AGCCAGGACTTGGGGGCCAACAAGTGGGATGGTGGTTAAGGCACTGGACTCCTACATGGT
CGACTGCAGTTTGAGTCCCAGACAGACAGTTTGAAAATCACTGGGTTGGGGCCGACAGGT
GGCATGGTGGTTAGTGCCATTGGACTCCCACATGGCCAACTACGGTTTGAGCCCTGGACC
TGGTGGTTTGCTTTCTCACTCTCTCACTCTGTCTCTCTCTGATCAAATAATAAAGAAATA
GAGCTAAAAAAAGGAAAGGAAAGAAAGAAAATCACACAGGGTACACGCGTGTCCCCAAAA
TCCTGAGAGAAGGGATTGTGGGGTGGCCATCTGCTCTGGGGAGTGATTTATTTTTCTTTT
TTTTCTTTTTTTTTTTAAGAATTATTTAAGTTTATTTATTATTTTCCAGTTTGATCAGAG
AGAGAAAGCAAACCACCAGGTCCAGGACTTGAACCACCATCAGTCATGTGGAAGTCCAAC
ACCTTTAACCACCATGCCACTTGCCAGCCCCTTTGGGGGGTGATTTCTTACTTTCCCTCT
GGTGAGCATGCACCCTGTGGCAAAAACCTTAAAATTTAAAAAAAAAGGATTAGTGTTTTA
TTGTAAGCATTTCAAAGAAAGAAATCCTAAGACTGGTTTCTGTGCATTACTGGAAAAGAA
ACAAGTATTCCAGCTCTAGGAGGGTTTTCATTCTCTTTGGATGTCGGGAGCTGGGAAACT
AGTGAGGCAGAATTGAACTGGGGTTCCAGGGGATGGCATCTCCTGCACAGGGCANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTAGCTCGCGTTCAGCTCACCCTTCCCATGTGTAAGCGTCGGGAAACGAGCTCTGG
TCCAGGCGGAGGCCAGTGCCGTTTGCCAGTCTCAGAAAGTCTGTAGTTACCCCCGCCACT
CCCCCCACTGAGCCCCCCATAGCACAGTAGCTAAGCTGTGTGCCCTGGCCCAGGAGGCTG
GGGGAGGTAGGCCTGAGTGTGGGCAGACTGACAGGCTGAGCTGAGGGGCACAGGGCTGCC
ATCTCAGGGCTCTGCCAGGCTTCCTGCCAGCCAGGCATGACTTGTCTCTGCAGAGGGAGA
CACAGCCAGAGGAGTAGCTTGGGTCCACTGTCCACAAACCACAGCAGAACACTCAGTCTG
TAGCTGGATTGGGAGGGATGGTTCAGGGGAGGCAGGGTGTGGTGCCTGGTACCCCCAGGA
CCAAATTACTTTAAAATCCTAACATACCCCAAAATACTGTTAAAATTGAGTGACTGTTAA
TGCACATTAGTACATCTCTGTGTGTGCCTACAGAGAGAGATGATTTTGTGACAGTAGTGT
AGCAGTACACCTGCCTCATTTTTATTTTATTTAGCTTTTATTTAATTAGTTATTTCATTT
GACCAGAGAGGGACAGAGTGAGAAAGAAGGTGAGAAATTAAGCCACTAGGTCCAGGACTT
GAACCGTGGTCTACCATGTGGGAGTTCAGCGCCCTTAACCACCACACCACCTGCTGGCCC
CAACCTGCATTGTTTCAAGAAGTATCAAATTTTGCTTTGCCGAAGCTTGCGTGGCATTTG
AAAAGCCTAATAAATTGAATCAACTGGAGGGGGAGAAAAACTCTCCTTGGCATTCCCCTC
AGGCCTGTGCTGGGAGAGGCAGGATGAGAGTACCGGGGTCCCCGTGATGTCCAGCACTGG
GCTCTGACCACCCTGAGGACATGGTGCCCCCCGGGACCTTTGACACCCGGGGGTCTGAGG
GGCCCCAGCTCTGAGGAGGTGCCGGGCGGGGACTGGCCATTGCCCCTTCCCAGCATCTCC
TCTCTGTCCTCACTATAGTGCCTGGGATGGTGCCCTCAGGGCCATCGCGTTTCCTGCCCA
GCTCGGGCAGCTATTCTGCCTGCACCGCGCCCTGGCCGTTGTGGAATGTCGTGCAGAGCC
CCGACGAGCTCATGGTCACCAGCAGGGCCAGTCCCATCTCTGAACTCCCGGGAGCTGCGT
TGGCTGTCCGCCTGACCCGTGATGCCATCGAGTACCACAGTGAGGCGCTGCGGGGCAGCT
GCCGTGGACCGTTTCCTCCACATCGGTGACGCGCCCTCACCCAGGGCCTACGGAGATGAT
GCCTGCTGCAGGGATGCCTCGGAGCTGTGGCCCTGGCTGGCCAGCCTGCTGGTCAGGGCG
TGGCAAAGCTGGAGGCTTTGACAAGATCCAGGCGACTGCCAGTGGTGGTGTCCCTGGTTG
AGGGCATGCTGGCCCAGCCCACATGCAGGGGCTTTATAGGCTGGCTCCTTGGCCCGCACG
TATCCAGGGTGAAAGTGGGCAAAGCCCCCTAGTGTCTCGGACTCTGTCAGAGAGGCCGTG
GCAGCATCTGGTCACGGCCTCAGGTGCTGGAGTCGTCTCAGGAGAGCACCCTCCCGTAGT
CTCCCCAGCATCCTATGGGCAGGCCACCCCTGATGCCAAGTTTAGGAGCCTCAAAGAGGG
GTTTCTTCTTCCCAGTCGTCTTCCCCCCCCCCCATTTGTACACTGGCTCCTCAGGAGTGA
GCACAGGCAATAAGTTGGTGGCAGGACACTGGCCATACCTGGGCCCCAGGCCCCAGGGAG
ACCCTGTGGCCCATGACACGAAAACGCCTTATATTTGCCCCCTTTTAAAGATTTTTTTGA
AATACAACCTTTTTACTTAGTGCTCCATCTTTGTGGTGTTTGCATTTTGTTGTTCTCGTG
TGCCTTTTTCCTTGCAACTCCTTTCCCTTTTAAAGTGTGCTTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved