Tupaia_belangeri Locus Mono:94:SNORD20
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:94:SNORD20
Tupaia_belangeri
Mono:94:SNORD20
scaffold_133926
SNORD20
1001..1080
2080
GATTCTTTTTTTTTTAATTTTGCCAGAGGATATGTGCATTTGCTAAAGAGAGAGAAGAA
GCATTAGTACGAACGCTTTAGGTAATCATTTAAGTGCTTTAAGTATAAGTTCAAGTGTCA
TCTAAGAAACCACTTACCAATCCACCATAATAAAAATTTAGACCTGTATGTCCTCCTAGT
GAAGTTATGGCTTTAGTCTTACTTTTTTCATCCATTTGAGTTCATTTTTGTATATGGTGT
GGGGGTAGAGTCAAACTTCATTCTTTGCATGTGGATGTCCATCTGGATCCCCGTTTGTTG
AAATAACTATTCTTTCTCCATTGGAATGTCTTGCCAGGTTTTAGATAAATCAATTGACCG
AGTGTAGGTTTATTCCTGGGACTTTAGATTCTATTTCTTAGTTTATTTTTCTCTTTATGT
TGGTACAACCCTGTATTGGTAATTCTGGCTTTGTATTAATCTTTTAAATTTGGACATGAT
TCCTCCAACTTTATTCATTTTTTTCAAGATTGTTTTGACTATTTTGAATCCCATGCATTT
CTATATGAATTTAGAATCCGCTTGTAAATTTTATGCAAAAATCACGTAGGACTTTGATTA
CATTGATTCTGTAGATCAACTTGGGGAATACTGACATTTTAATAATATGAGTCTTCTCTC
ATCATACATGATTATTTTATTCAGGTCTTCTTTGGACATTCATCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAC
TGATTTGTTTTTAATCCTTCCAATTTTACCATCCTACATGTTGAAAAACACATGATTTTA
TGAGGAAATAAACTGATAAATCTCAAGAAAATTTCTCCCAGATAGTCAAGTTCTGATCCA
GCTGTGGGGGAAAAAAGCAGCTAGTGCAAAATTTTTTAATGCTACAAAATGTGTTCAACA
CAATGTTAAGTATGTAACTTAAAATAAAAATATGTTATCCATCAGACCTCAATTACGAAT
GGAGGAAAATATGGAAAGAAACAAGAAGGAATTAATAGTGTGTCTCTTTAGATGGTGAAA
TTATGGTTGCTTATTATTTTCTTCATAATTTTCTATATATTCCAACAAGTTAATACATTA
CTTTTATTACCAGGAGATAGGGAAATCACCGAAAATCAGCATAAATAAATTTATTTTGTA
TGAGAAAAAGAGAGAGAGAGAGAGAGAAAAGAGACAGAGAGAGATAAGTTTAAAAAAAGA
GTAACAGCACCAGTGATGAAGTGAGAACAAGTAAATGTGTGAGGTCAGGGAAACTAAGCT
ATAAGACTGTATTCTAAGTGGCTGACACTGATGAAAAATATCTTGGTTCCTGGGTGAGAA
AGTGAGAAAGTTTAGGAGTAGCTGGAACCCTTGGGGATGACACCCTGGAAGAAAAGGAAA
CTCTTGGAGTGACTATTCTACAGATCAGCAAGTTGTGAGCCACCATGTGGGGAGCAGAGC
CTACCTGTTTAGCGGACAAAGGGATTAGAATAAGATCCAATTTAAGAAGTCTTGTGGGCC
TACTTGGGCACAGGAATGTGAACTTGAGTCCATGGACAATGGAAGCTAGTAACCTTTGTC
ATTTTGGTTGCCATGATACGTTGAACCTGAAAGTCATGGGTTCCATGACTCAAAAGTGGT
GGTGAATATTTGAATCAATAATTTTCCATTTCTGTAGGTAAAATGATAAGTTGAAAACAA
TGCAGGAAGTGCCACATGAACTTAAAGCCTTGGCAGCAAAAGGCAAAGATGAGAATTCCT
CAAAAATAAGCCATCTTTTTAGTGGTGGACTTACACACTTCCACTGCAAAGTCAATTACC
TGGTCTATGTCATGTACTTAGTAAGTTTTGTTAACTATGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved