Tupaia_belangeri Locus Mono:156:SNORA3
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:156:SNORA3
Tupaia_belangeri
Mono:156:SNORA3
GeneScaffold_4328
SNORA3
1001..1128
2128
TGAGTATTCACTAAATTATGACAGCTGCTTAGGATAGGTAACAGAACATTGGTACTTTC
AATTCCCAAAAATCTGAAATATTTTTGTAGGCTTAAATGCAGCAGTACCGAAATTGTTGG
AAAGCTAGACAAGAACTCAAGAAGCTCTCTATTCTTTTATGCATTATCTAAGCAGAAAGA
CTCTCATAATTATCTAACATTGTAGGCCTTCCTTTAAAGATCTGTAGGAGCACCCAGTGA
GAGACTGGATAAATAATGATCTCTTAAATATTGACATAAAAAAAGTAGAAAAGTGATATA
GACATATATAGAATGATGTGGAATAAACTGTATTTATATTGTTAAATGAAAAAAAAAGGC
AGCAAAAATGAACATTCATATGTCCTCATTTGCCTAAACATAAAAGATAATTTATAAATA
AATTGCAACTTATAGATGTAACAACAGTTTCCAGAGAAGTTTACACCAAAAACTGATTCC
AATGAAGTGGGAAGAGATGTGTTCCACTGAACACTCTTGAATTATCATGAGTCCCATCAT
GTTTGCAAAAACCTTGGGGAAATATGCCCACTCATGATTGCCAAAGTAAAACTACCCTCC
TCTTCCTTTCCATAAAAAGAGAAAATAAAGACATCTCTTTGTAAATTGAATGCATACTAA
GTAAATTTGACCAAACCAATCAATGGGCATATAGTTTCAGTCAAGCAATATGAGTAAACT
CTAGAGATCTGTTGTGTTACACTGTACTTATACTCAAAAATAATGTATCGTGCACTTACA
AACTTAAGAAAGTATATCTCATGTTAAATATTCTTACCACCATAAAATAAACTACTAAAA
GAAGATAAAGAAATCTACAGCTTTATATAGTTGAACCTATGTGCCTTTGACCTTAACATA
CCCACATGCCACTTACTCGCTTTGAAGAAATCTCCAAAGAAATGATAGGAACTGGATCCT
GCAATAAAAAAAAAAATCCTTTTTAAAAAAATATAATAATGAAGACTAGCATTGGATCCT
GACACACCTCTTGTCCTGGTGTGCTTGAGTTCTGGTAGAGAACATGCTGGTCTTGACTCG
CTAGTGGGGGCAATCGATGCCCCTGCCAGGGCCCAGATTGGAAATATATCTAACTGGATC
CTGGGACGTGTGGATTGGCAGGTTTCTGTCCTATATCCGTCAGGGAGTAGGAAAGAAACC
TGCTGCGGTGTGTAGTCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGCTAATACAAAGTTTGAGGGAAGGGAAAGCTCCTAAATCAAGCCTGTCATCATGAAGGC
CAAATTCTTCAGCAGAAGAGCCAACGTGAAAATTCAGTGTGTGTGTGTGTGTGGGGGGGG
GGGCACACATAGTGTCCTGGGGACTTGAAGTCACATAGAGAAAGGTACATCAACTGCTAA
CACATACTTTTCAAAAAAAAAGAAAAGAAGAGAGAAACTGTATATTACCTTAATATAATT
GTAAATCACCTGGAATCAAATGAGGTATATAAGTGGTTTTGTGGCAAGAAGCCTAAAGTT
TTCATTTTAGTAAATCAATATGCAAATACAATTAAATTAAAACATAGCTTTAAACAATCT
TTTCTAATAAAGAGGGACAGATACAGAGATGAGAAAAACAATGGATAACCTAACCAGACT
ACTGTTTGTCTCTGTAATATAATTTTCATATTCATATTTGAATATTATGCTTTTGGAAAG
TTAAGTGTCTAAAAATAAAATAATGTAATCAGAATACTCTTTGCTTTTATAAAGTAGTTG
AACCATTAGAAGTGAAGCAATTAGGTCCAGCAGGTGGTGTGGAGGTGAAGGCAACTGACT
CTCACATGGACAGCTTCACAGTTTGAGTCCTGGACCAGCAGCCTGAAAATCATGCCAGGC
ATGCGTGCCCAAAATCCTGAGAAAAGATAGAGGAGAAGGGATTGCAGCATGGCCTTCCCC
CTGGGGGCCTGATTCCTCATTGTCTCCCTCTTTCTTTCTCCAACAAGCACACAAATCCTA
CAGCAAAGCAAACAAGCAAACAAACACTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved