Tupaia_belangeri Locus Mono:139:SNORA30
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:139:SNORA30
Tupaia_belangeri
Mono:139:SNORA30
GeneScaffold_2505
SNORA30
1001..1127
2127
GTGAGGAAGGCCCTTGTTTCTAACTCCAAACTCATTGTCAAAATTGTACTGTCCTGGCA
GCTGCTATCTTGACTCCTTCTGTGTGGACTCAGCATTCCCTAAACTGACCTCTCCTGGAG
ATGGTATTCATGGGAGATTCCCAGATTATCTCCTGGGAATGTTCTATGCAGAGAATCCGC
CACCTACTTTCTCTGGACCCTAGACTCCTGGACAGCTGCCCTGGCCTCTCCAGTCCCAGA
GCAGTCATGACACCTTCCTCTGTAAACAGAAATGCCTACTTCTCATTTACTGGAATCAGC
TGGAAGTCCTCAGTCTCCACCATGAAAAGTTTTCATACTTGCTAATAGTATTTCCAGGGG
GAGCAGATGGCTGAGCAAGCACTACATACTATTTAGTCTTTATTTTTATTTATTATTTTT
AAAAGGTTCACTATAGGGCATGTGTGCTTGCCAGAGAAAGATAGAAAAAGAGAGAGGGAA
AGTGAGAAACCACCCCCCACCCACCTGGGAATAGCCATGCCACAATTCCTTTTCCTCCAT
TCTCCTCTTGGGATTTTGGGCATACACACACATTCACCCTGCATGATTTTCAAGCTACTG
GATCCAGGACTCAAATCATGATTGACCATGTGGAAGTCCAGCACCTTAATCACCACACAC
CTGCTGGCCCTGCAAGTGTTTTTTAAACTCAATGTTGGACTTCAAACATAATATTGCCCT
GAAGTTTGGTGTTAGCAATTTTTAGACTCTTATGCTACTGCACGTGTAATGCATGTTTAA
TTCAAAATGTAAATGTAGTTTCACTGACTCAGTGGCAGACTAGGTAATTCTGATGAGTCC
TCCTGGGCAAAAAAAAGGAATGCTTTAGTGAAGTCTTTGGAAAGCTAGCAAAACAGTGAA
AAAAAGTAATGATACTTAAACCTGACAAAAGTAACATAAAAAAGAAATTTGCAAAATGAT
AGAAATTTTAATGCAAAAAATAAATAAAATAATAGCAAATTCTAGCACTTTCACATGCCC
TCCCCCATGTACTGAGGCTAAGATTTGATAACTGGTTCTGAGAAAACCCTTGATTACATC
CTTGTTCTGGGACTATACCAGTGACAACTGTCAGTCAATGGGACAGAGACGAAATAAAAT
AAAATACAAGTGATTCCGACAAAATATTAAGAAATAATTATCCAGGGGAACCAACAGTTA
GCATAATGGCTATGTCACTGGACTCCCATGTAGTCGACTGCGGTCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTTCAGCCCCTGGATATATTTTTATTGATTTGTTT
CTGGAGGAAGCTTGTCCTAAAATGTGTGTAGAAAGCAGGTATATCATGATAAAGTTGTGT
AGTGTATGTTCTATGTGGAATTCAGAGGAAACCCAGATTCAGTGATTAACAATGCCAAAA
AACGCAAGTAACTAGCCATTGTTCAAATGACAGTGGTGCTATTTCTCTTTTGTGGCCCTT
TAGACTTTTGTTGTCCCTAAATTCCATTTTATTGGAAACCCATTTTCTACCTGGTCTTTC
TTGACAGGGTTTTTTTCTGCTTTAAGCAGTTTCTAAATAAAATTCTTTATTTCAATAAAA
AAAAATAAGTCAATACCAATTTCTAATAAAAACTACTGAATGAAAGGGGATTTATGTTTG
TTTATTTATTTATTTATTGGGAGGTTTTTCCTATAGGATGTGTGAGCTTGGCAGAGAGAC
AGAAAGCAAGAAATACAACCACCACCACCGCCACCCCCGAGGGGATGGCCATGCTGCCAT
CTTTTCTCTTCCATTCTTCTCTCTGGATCTTGGGCATGCTTGCACATACACCTTGTGTGA
GTTTTAAGCCGCTGGGTCTGGGACTCAGACTTCTGTTGGCTATGTGGGGGTCCAGCAACG
TAACCATTATGCTTCTAATGTTCCCAGTGAACGGTACTTTCTCTTGAAACAGACAAATAG
ATTAAAAATACTTAAGGGTAAAGTTAAGAAGAAATGCTCAAAACATACATCAAAAAAATT
GTGAAACACTCCTGAAGGCATGAAGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved