Tupaia_belangeri Locus Mono:83:SNORA44
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:83:SNORA44
Tupaia_belangeri
Mono:83:SNORA44
scaffold_117035
SNORA44
1001..1120
1206
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCTAGTATGATAACCCTAAAAGAAGAAAAAACTCCAAAT
CATTTATTCTTTTGAGAAATTATTATTAATTTAATTTTACTTATTCATTATTGTTATTTT
GTTTGCTATAGTACACATACATCACCAGAGAGAAGCAGAGAGAGAGAGAAAGAGAGCTAA
GAGGAAAGTAAGAAAGCAAGTCACCAGGTCTGGGACGCGAACCATGGTCAGCCATGCAGG
AATCCAGCACCTCAACTACCATGCCACCTGCCGGCCCACATTAACTTTTACAAGACCTTA
ATAAATTATATTTCCCCCTAAACTTAATATTAGCTCCATATTAGCATAATTCTGGGACAT
TCATTCTGTAGTAGTTTCAGGGTGGCACTACAGTGTGGAAGTTTAGAAAAACTAGTCATA
AGTATTAGATGTTTAAAAACCTACAATAAATATTTTTCTTCAAATTATTACTATATGGGA
TCTTGGATGCTGAAAGGCTTAACAAGAGCTCTCTCTAGTCTAACCAACTATATGGTGCAC
ATTTTCCTTCTATAATAGAAAACTCACTTTTTTTTAAGAATGATTTATTTAATTAACATT
AAATAAATAGCCATTAATATTAAATAAATATCCATTATTATTATTTTTAAATTATTATTA
TTTTAATTTGACCAGAGAGAGAGAAAGAGAGAGAGAAAGGGAGAAAGCAAGCTGCCAAGG
TTCGGGACTCAAACTGCAGTCGACAATGTGGGAGTCCAGAGCCTTTAACCATCACACTAC
ATGCTGGTCCCGAAAAGTTACCTCTAAAAACAGTCTATCCTCAGCATGTTTCCAAGGGCT
GTGGCTGCTGGTGGCCACGGGTTCTCCAACGGCATGCAAGAATAACATGGAGGGGGAACC
AGCAGTTAGCCTAATGACTATGTTGCTGGACTCCCACATAGTCGACTGCGGTTCGCATCC
CGGACCCGGTGGCTTAGAACTCAGGCAGGGAGTGTGTGCGTACGTGCCCAAGATCCCAAG
AGGAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved