Tupaia_belangeri Locus Mono:142:SNORD100
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:142:SNORD100
Tupaia_belangeri
Mono:142:SNORD100
GeneScaffold_3608
SNORD100
1001..1075
2075
CTCCAAATCCTGTACTCAAATATCCATAGTGGTTTTATTTGCAATTGCCAAAAAGTGGG
ACCGATCCAATGGCCACTGACAGGTAAGTGGGTAAAGAAAATGGGGTGCACCCACACAAT
GGACTAGAATGAAGCAAAAAAGGCAGCAAAACACGGGCACACGCTACAACACAGACAAAC
CTCAAAAATCATCATGCTAAATAAAAGAAACCAACTCCTTCCTTTCCCCTCCAAAAAGGG
TATGTAACGCTTGTTTCTATTTATCAGAATTGCAGAAAATGCGAGTAATTCATTGAGATG
GAAACCACATCAGTGATTCAGAAATCACTGACAGGTAGAGGAGGGAATGGACCAGGAATG
ATCAAGATATTCTGTCTTCTATGTCTTGACTGTGGAGGGAGTGGTTTCACAGGTGTATGT
ATCTGTCAAAACTCATCACTTTTTTGTTTGTTTGTTTTTTGCCAGAGGGCACCTGCGCTG
ACCAGAGAGACAGAGAGAGAGAGGGAGAAGCATCCTCTAAGGGGTCACATGGCCACATGG
CAACCCTCTCTCCTCGTTTTCTCCATCTAGTTGGGATTTTAGGCATGTAACTAGTGTGTT
TTTCAGGCCTAGATTCGAACAATGCAGTCCCCAAGCACCAGTCCACAGAGCTGGCCCACA
CTGTATCTTTTAAACAGTAAGTTTATTGTATGCAAATACATCAACTAAGTGTATATTTGT
TATTTAAAATAAATTGCTGGAGCCAGCTGGTGATGTGGTGGTTGAAGGGGCTGGATCCCA
CATGGCCATCTACGAAGTTCGAATCCCAGATCCAGACTATGTGGAGATCAAAATCTTGAG
AGGAAAATGGAGAAGGGATAAGTGATGTAGCCATCTCCCCTGGGGTATGCTTTCTCATTT
TCCCTTTCTTTCTCTCTCTCTCCATCTCTCTCCAGTGAGTACATGCACCCTAGAGTGAAT
TTTCAAAAAACAATCATGATAAACTTTAAAAAATAAATTGCTGGGTGCATAATGACAACT
GGCTCCTCCTACTGAGCTGCTATGAGGGAAAAAAATTGCTAAATTCAGGACATTTATGAA
GTAAGCATTCTAAAACGAGAGTCAACAACTACAACCCAACCAAAATGCATGAGATTTCCA
GTGCTGACCACTTCACCAGCACCTTCAGAGATGGACTTTTAATTCACCGATACACGATGA
TCTGGTGGAGGGGAAAAGGACATGTTTATACTGATTCAGAACCTCACAGGGAAGAACTCA
AGGACCTAGGAGGCAACACCTTTTCTAGATAATTAGCATGAAAATGATTCTTTCCCTCCT
TGTAAACCCTAATCTTGGTAGAACAGAAACGGACACCTAGAAGCAGAGCCCTTGAGAAGT
TAGTCTCACCATGCAGGGGCGGTGGATGGGCTGAGACATTCAATAACCTCCTTTGCTTGG
TCCTTCTAAAAGGATGCTCGTGGTATTATTAGACCCCCGCTTATAAAACGACTTAATTCA
ATGCATTTGAAATAAGAGCAATCTCCTACCAGTGACACCGTTTTCAGGGTTTATTCTTAT
ACACTCAAAGAATGTACACATCGAATTCCCATCCAAGCCCAGCAACCACAACAGAGAACA
TTCTTAAGGGCGGAGGCATCAACATGGCAGCTTGTTCCTTTGTACAGGAGCTTCTCTGGC
TGCAGCTGTCACCCCCTGCTGTCCCTCCCTAAATGCAGGCATGTGCATACGTTGGCATAT
ACGCACAAGACTGTGTGACTATGCGCCACTCATGATCTCCACATACAAATAAGGAACAAC
CGCTAACACTCTGGTCCTAGAGTCCTGGGGCAGGCTGCCCAAGGGCAGGAGCATCTCTCC
TAGGAGTTGGTGGAACTGCTAAACACAAGGGACTGCTCATGTCTTTGGGGACGATTACCC
CGGGGCCATTACAGCGTGACAACGTGTCAGTCCTAGGGACGACTTCGTCTCATCCTTCTG
TATCCCAAGCCTACCTTGTAAGATCAGAGGTTGTGGGAAATTAGAGGTTACAGGTTACCG
AGGGTCAGAGGTTACAGAGAAGTTACTCAGATGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved