Tupaia_belangeri Locus Mono:85:SNORA18
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:85:SNORA18
Tupaia_belangeri
Mono:85:SNORA18
scaffold_15166
SNORA18
1001..1131
2131
GTACTAGATTTGGCCTCTAGAGGGAGATGCCACAAAAATTAAACTCGACACAAAGCCAG
AAAGCAACCAAGCCCTCTGAGGAAATGCTTTTTGCTTTGTAGGCTGGGTAAACTCGCCCA
CTACTCTGTCAGTGTGCTTGTGGCTGCACTGTCTCCAGAAAAGACTTCCAGAAAAGAGCT
GCCTGTCTCCTCACAGCTCAGACATGAAGCTCAGCCTTATCTTAGTGCTTGTGGTGGTTT
TCAGACTCAGTGAGTATTAACTTTTTCTTCCATCTTTCTATACTTTTCTGATTTAGAATC
ACTTTAATGAGTCATTATCCTCAGTCTGTAAGACTCTCTCTGACCTAGAATTGGTGTTAC
AGGAGGATCAAGGGCCCAGACAGTGACTCAGCCGGAGGACCACCTCTCTGTCTTGGAAGG
GGACCCCGTGCAGGTGAAGTGCAACTACTCCTATTCTGGGAGTCCTGTGCTCTTCTGGTA
TGTGCAGTACCCAAACACGGGTCCCCAGTTACTCCTGAAGCACATCTCAGGAGAAAGCAC
CAAGGGCTTCACGGCTCATCTTAACAAGGGAGAGGCGTCCTTCCATCTGAAGAAATCAAC
AGCTCAGGAAGAAGACTCAGCCACGTATTACTGTGCTCTGAGTGGCACAGCAGCTGGTTT
TGCAAAGGAAGCAGAGCACAAACCCTTTAGGACTTGTAGAGAATGTTTCCTCTATATGGG
CACAGATTCTAGCCACCGACATTGAGTTTACCTCTTAAATATAATGCAATATCATCAGTT
ATCAATTAAGTATATATTTACATCAAAAATGTGTCCAGAAAAATTCTTATTACCTATGCT
GCTTAAATTGGTTAACAAATAGTACTTGTATTCATTCTGTCTAGTATTGGGTCATTGGTA
AAGTCATGATATGTTTTTCTATGCAAAAGTGTGTCCTGAGTTTTCTGACTACACAATAAT
ACCTGCAATAACTATGTCTGAAATAAAAACTACATAGCACAGTTGAGGTCTATCCCAATG
TGGCTTTTCCTGTAGCTGCACATCGTTGAAAACGCCTCATAGAGTAACAGTGTGGTTTGC
TTTACTCACAGGACTATTTGTTAATTCTGTGAGAAAGAACTACATTACAGAATAACTAAA
AGTATGAAAGATCTCATAATCATTTTCTTATCCAGGTATTAACACATCCCACAGATGTTG
AGGAACAAGTCTGAACTGATTTCCTGTGTAGAAGGTGTCAATTTGAAAACCAGGCAGATG
CAGTCATGCTAAAAGTGGCCCGAAGTCAATTATTTAAAGAAATTGGATCCCAATGTTCCT
GGGTGGACAGACTTTGAAGTTACCAATATGTCCATAGTTCTAATGGAGAAAAAGGAAGAC
ATGAAAAAATTGTGGTAGGGCTGACAGGACAACTATGAATTAAGTACCAGTTCTTTTAAA
AAGGACTATCTTGACTTGGGCTTTGGAGGAATGAAGGTGGTGGTGTCCATNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved