Tupaia_belangeri Locus Mono:44:SNORD59
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:44:SNORD59
Tupaia_belangeri
Mono:44:SNORD59
scaffold_116044
SNORD59
1001..1071
2071
TCTACATGGCAAACGTGGTCAGTCCCGGATCTGGTGGCTAGCCTTCTCACTTTCTGGAT
CTGGCTCCATCCCTCTCTGGTCAAATTAAAATAAATAAAGTAACTCTTAAAAAAAAAAAA
AAAAAGGTAATTGGACTTAATGGGAACATTTAACACTACTCTTTTTTTTTTTTTTTTTAC
TTTATCTTTTATTATTATTATTTTTTTGGAGAGGTTTTTGCTATAGGGCGCTTACCAGAA
AGACAGAGACAGAAAGTGAGAAATCACCCCCTAGGGGGGATGGCCACGCTGCAATCCCTT
CTTCCTCCATTCTCCTCTCAGGATCTTGGGCACGCATGCACACACGCCCAGTATGAGTAT
AAGCCACCGGGTCTGGGACTCGAACCACGGTCGACTACATGGGAGTCCAGTGATGGCCAT
TACGCTAACTGCTGGTCCCGACTTTATTTTATCTTTTTTTTTTTTAAATTTGCTATAGGG
CGTACATGCTCACTAGAGAGAAGGAAAGTAAGAAAGCAAGCCACCAGGTTCAAGACTCAA
ACCACAGTTGGCCATGTAGGAATCCAGTGCCTTAATTACCATGCCACTTGCCAGCACCCT
CTTTTTTTTTTAAGAATTATTTAATTTATTGTTATTATTTCAGTTTGATGGGGGGTGAGG
CAAGGAAACCAACCTCCAGGTCCAGGACTCAAACCATGGTTGGCCATGTGGGAGTCCAGT
GCCTCAATCACCATACTATCTGCCCCCCAATTTGTTTTTATTAAGGTAAATACATACTGA
GTCTCTATTATACCTTTACAGGTTTGCTCCTATTCATGCTGAGGCTCCTGAATTCATGGA
GATGAGTGTTGAACAGGAAATTCTGGTGACTGGTATCAAGGTTGTGGATCTGCTAGCTCC
CTATGCCAAAGGTGGCAAAATTGGTATGTTAGCACTGGGTACATATTTTGTAAGGCTAAT
ACGGGAGGGGGAGAAATCACCATTTTATGAGTGGGTCCATTCCTTGCTGATGAGTAGCTT
CTGACTTTCGTTCTTCTGAGTTTGCTGAAGCCAGATGACATTTCTGAGAAGGAAAAGATG
GAATGAAACATTTTTTGAAATTTGCTTATTTGAAAATGCAGAACTCGTAATACTCTTCTG
AATCTGTCCTAGGGCTCTTTGGTGGTGCTGGCGTTGGTAAGACCGTATTGATCATGGAGT
TAATCAACAATGTTGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGA
GAACCCGAGAGGGCAATGACTTATACCATGAAATGATTGAGTCTGGTGTTATCAACTTAA
AAGATGCTACCTCCAAGGTAAGCACATAGTAATAGTGCTGGCAGACTATTGGCAGGTGAA
GTCAGGTTTTATATTTTCATTTTGTTGTCTCAGGACCTACAAGGAAATTCTTGCTAGTGT
TTCCCATTTTAAAAAAAATACTTAATTTTATTTATATATTTTTTAAAGAAATATTTTACG
TGGCTTTCTTTCTTTTTTTTTTTTTCTTGAATGGTTTTTGTTATAGGGTGCGTGCGCTTG
CCAGAAAGACAGATAGCAAGTGAGAAATCATCTCCTGGGGGAATGGCCATGCTGCAATCC
CTTCTCCATTCTCCTCTCAGGATCTTGGACACATGCACATGCCCTTGGCTTGAGCTTAAG
TCACTGAGTTGAGACTTGAACCGCAGTTGACTACATGGGAGTCCAGCGACATAGGCATTA
CGCCAACTGCTGGTCCCATTTGGCTTCCTTTTCTTTTCTCGTCTTTTCTTTCACCACCTG
CCGGCCCCCTTATTTATTGATTTTTATTTGACCAGAGAGGGACAGAATGAGAAAGAGAGA
GGGAAAGAGAGAGAGCAAGATGCCAGGTTTGGGACTTGAACTGTGCTTTGTCATGTGGGA
GTCCAGCGCCCTTAATCACCATGCCACCTGCCAACCCCTTCTCTCCCATTTTTAATATAC
TAATGCATAGTTTCATTTCTTTTTGGCATTATTTCATATTTTTAGACTTTTCTTTTTAGT
AGATAGTGCCATCATTTAAAAATAAATTTAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved