Tupaia_belangeri Locus Mono:78:SNORA3
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:78:SNORA3
Tupaia_belangeri
Mono:78:SNORA3
scaffold_111819
SNORA3
1001..1125
1579
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTAAACTATGACCTTTTGTCAAG
TGTTGTAACACCACCAAACACATGGAAAGAGAGGTGCCGGCATTAGGCCCATTGGGGAGT
GTGGGTTCTTTCTATAGGATCAAATTACAGTACAAATCCCTAGAAAAGAAATGGCTTGCT
ACACTGTGGTCCTGCCTTAGTTGTAATTTTGAACTTTTAAAGCCATTTAATTAAGATGGC
TATGATGGGGCCAGCAGGTGGCGTGGTGGTTAAGGCGCTGGACTCCCACATAGCCAACTT
CAGTTAGCCTCCCTGACCTGGAGGCTGGCTCTCTTCTTTGCCCTTTCTCTGGTCAAATTA
AAAAAAAAGATGAAATAATCCTAAAAAAAAAAGATGGTCATGATGATTTAACCTGTCATA
TTTGTTATATTATTCTGTTATTAAAAAGAATTTTATATTTTCTCGAGGTAGATTCACGCA
TGGGTATCCACAGTTGCCTTAGTGTGCTAGAGCCCTCTGAGAATAACTGCTGGCCTTACT
CGCTAGCTGTGGGCCTTGTGGCGCAGTCACCGGGTTAGTGACAGGCGTTGAGACTGACCT
CCACAACCGTTAGATCTGCCTGTATTCATAGATCAAGGGATGATATGTTTAGACTATTTC
TTTCGGAGACCTGTATTACAGGAACGTGTGCATTTTCAGTAAATACTGGCATGGGACCTG
AATTTTAGTTTTGGTGCTGCCTCTCATTTCCTGCTTCCATAAAATAGGACTAGGTTTTCC
TCCTGATATTCTTCAGTGTTTCTTAAAAGATTTGTTTGTTTCGTCAAATGCACCAAGTGC
GTGTCGGGTTCCCGTCACTGAAATACTGATGAGCAGTTTGCACTGTATGGAGAGAGTGCA
TAATATGAGTGTGAAGCTGATGAACAGCTTTTATCAGTAGTTGGAGTGAGGTTATGAAAG
TAGGAAAAAAAACCGAATTTTATATTTTCATTAACCTCTCAGAATTTGCTAAGTATTTCT
GATTGTGCAAGTAATTATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved