Tupaia_belangeri Locus Mono:36:SNORD42
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:36:SNORD42
Tupaia_belangeri
Mono:36:SNORD42
scaffold_117380
SNORD42
1001..1069
2069
NNNNNNNNNNNNNNNNNNNNNNCTGCCTTGGGCTGGCAGATAGTGTGGTGATTAAGGCA
CTGGACTCCCACAAAACTGACCCAAGACTGATCGTGGTTTGAGCCCCAGGCCTGGTGGTT
TGCTTTCTCACTTTTTCTCTCTTCCTCTCTCTTTCTCTCTTGATTCTCTCTGGTGAGTGC
ACACACCCTATATCAAATAATAATAATAATAAGTAAAATAAAATTCTCTAAAAAATAAAA
CTGTCTCTCAGACAACTGAAACCAGCTCTGAGTGTCCAGTCCACTTGTTTAGTACAGATA
TAGTCTGCACAAAAACTCCTTTGTTCTGAGCTGCCCACGGTGGTGAGGTGGTGAGTCGCA
AGGATTCACAAGGGCACAGCTATACCCAAGTCATCTGTACTGGAAACAGCACTGTCCTTA
AAACTGCCTGGTACTTCATCATTCAGTAGCTGATCACTTATCGAAATGTAATGTACCCTT
GAATACCTTTCTTTGGATTGTTTTGTCCTTGGGGATCAGTATAAATGAACAGTATGTGGT
CTGAGGGCAAAGAGACCTAAGATCCCATGGCCATCCTGCTGTTTCCTTCAAGACCTTTGG
GACACATCATTTTACCTGGAATTATCTGAATTGTGACTCAGGTAAAAATAAGGCAGGGTT
AATCATTTCTGCCATAAGTTGTTCTTTTGACAATGAGAGGGTTTAGATAGAACACCTCTA
GCAGACAGCAGCTTGCATAGTACCCACTCAAATGAAACCCATTAAATGAAAATGTTAGAA
AAATATCTGAAACCAAAAAAGCAAAACAAAACCAAAAATTCTGACTATTAGGTAGTAATA
CCACAAACTATCTTATCAAATAGCAACAAAGGTGCTTTCTCTTAACTACTTAAAAAGCCA
ATTATTAGACCTTTTTAATGAACTGCTCAAGTGAACCAGCCCCAGGCAGAGGCTCCATAA
GAAAAACAACGTGTTGTTTAAAAAAAAAAAAATTGTTTTTTTTCCACAATGATGGAAAAG
ATCACTATTGGGGGAAAAAAATGACATGAACAAAGAAACCACAGATGGAAACAAACAAAT
GTTCTTTATTCATGAAAGCATCTATGTGCACACATGAGAGAGAGAGTAAGAGACAGACAC
ATGTGCACCCCCCACCAGGTCTCCTCACTCTGTGAGCCCCTTCTCCCAGACCTCCAGCCC
AGATACGAACCTCAGCGGCCATGTGGGTTCCAGCTTCTCTTGAGCAGCTCATTATTGCAG
TACCACAGAGCTTGTCCACATGTGTTATAGTTAACTCTTTCTTTTTAAACAAATCTTTTT
TAGTTTAATACAGAGTTATCGTCACCAGGAATAAAAATGTCACGGTAAGCAGTTCTTGTA
AGTCAAACCATTGTACATACAAGCCTGAAATCCTGCCTTTCATATAAATAGATAAATATT
CATGTGTTAAGAGCCTTTTATGTATATGTAAGCCTTCCAACCAGAAAGAACTATACTGCA
TATTGCTAAAGGAATACCAATTCTCAGAAAAAGAGAGGCCCCTAGATATCCTTCATTCAC
TAACCCCCTTTTATATTTGAGTCTAGTGTCCCAAGACAATTCATTGTATCTTTATGTGGA
CATGGTTACAGCAAATATCTGAGCACATTTATGGGATGTGACATATAATATTATAATGGA
GATGAAATCAATATATACTCGCTTATTTTACTTTTTATAATTCGCAGACTTTACAGAAGT
TACTTTATTTTTATGTTTCCCAATGTTCCTCCAACAATTCAGAGACAAACACCATGCTCT
CTATTACAAAATGGTAATTACAAAATATTCAGAATTTGTTGAGTTTTGCATGTTATTGTT
ACTGTTGGTAACATTATACTCTCGTTCTTCCTTTCTTTTTTTAGCAAGAAAGTTTTGCTA
TAGGGTGTGAGTGCTTGCTGGAGACACAGAGAAACAGAGAGACACAAAGTGAGAAATCAC
CCCCCTCAGTGGGGATGGTCACACCACGATCCCTTCTCCTCCTCTCACAGTTTTTGACAT
ACACACACATGCACCTGGCATGAGTGTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved