Tupaia_belangeri Locus Poly:2:SNORD116
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:2:SNORD116
Tupaia_belangeri
Poly:2:SNORD116
scaffold_9992
SNORD116, SNORD116
1001..1092, 5088..5179
6179
CACTTGGTCAGATGTCAAATGAATCAATGGAAATTGCCCTATCTTCAACAGTGTTTTTG
TCTTCTGTGAGTCCCTAGTGTACTACTGCGGTGACGTGAATTGTTCCTGGGCTCCATGAC
GAGGGCTTGTGTGTGGGGTGGTGCAGATGAGAGGTGCTGCAAACCATGTTTTATACTGAG
GGTGGGCAGATGTGGCCCATTGGACAGTGTGTTGGAGATGCCACGTGCGATGTTGAGAGA
GCCCATGGCGAGGTACCTCTCAGTTTATAGCTGTGTGTCTGCTGCTGCGGGGACACTGAC
AGTGGACATGCTCTTCGTCCTCTAATGTGTGATGAGGAAGAGATGCCATGTGAGATGCTG
AGAGAACTCATGGTGAGGCGGTCCTCAGTTTATAGCCCTGTGTCTGCCCCTGCGGGGACA
CTGACAGTGAACGTGCTGTTTATTCACTAATGTGTGAAGAGGAAGACTAAATGGCATGAT
TGGCCAAATGGCTCTCAGAGGTGAGGCCCACAGGTCACAGAACTCCAGCCTTCATATGCA
GTAGAGGTGTGCGGGACCGTGGTAGTGCCTGCAGGCATGAGAAGCCTACGTGAGCAGCCT
TGTATCTGGGAAAGCGGCTCTGGGGTACAGAGACGAGCATTTGATGCCAGTGAGACCGAA
AATGGATGTCTGGGTGCAGAGAGTCATACGTGTGTGAGCACGTGACAGTGACAGGCTAGA
TGTGTTCAGCTAGGTGACACAGTGCATTGTCCTGGTGCCTGGAGAGCCTGTCTGTGCTGC
TGAAGCACATTTGAGTTGTCACTGCCTGTTGCAGGTCACTCTACGAAATGAAAGAGATGT
TGAGGAGGGAGCGTCCTCCTGTCGAGAGGTGCCTGGTTATGCTGGAAATGTAGGCGTCCT
GTGAATACTGCCTGTCACATTTTGCTGCGTCTCTGTTTCCGGTAAGCCTGTTTTGTCAAC
CTTGCAGCCCCCTTCAATTTCGAGAGACAGAAATTATGCATGGATCGATGATGACCCCTA
AATATACATTCCTTGGAAATCTGAACAAAATGAGTGAAAAATCTCAACCGTCATCTTCAT
CGAACTGAGGTCCAGCGTGTTAACCCAGTAAGACCCAGTTTGACCTGACTGTGCCACGTG
GGTCTTTGACTGGAGGAGATGCACACGCACAGTGCAGGGTCCTCTCTGTGTGGGTGACTT
CCGGCTTAGGAGATCGGTGGGTAAGTGGTGCAGTTTGCTGACTGGGCCTCACACACAGAG
GTGTTAGGGTTAGGTGATGGCATGCGTGGCACAGGAAGAAGCCATATGTAGCCTCTGTCT
CTGTCCCAAATGCCCCCAGAGTTGTCTTCCTACCTCCTCAGAGGGAACGTTGGTTCTTTG
TTCAGGAGTAGAGCTCAAAGCTGGGTCCCCTAGGTCCTTCCTGCTCTTTTCCTGATTGGC
AGAAGAGGCTAGCATGCCTTTGGTTCTGGACAGAAAAAGTGCTGGTTACTCTTTGGAGTA
TGGGGACATGGATTTCCCTGACTTGGGGAAGCCAGGGGGAGGCCTCCTCACTGTAGAAGC
GTTAAGTCCCCTGAAAGGTACTGTTGGGAGGGGGAGAGGCTGTCATGTCCTTACTGGACA
CCCTTCCACTTTGATGTCTGAGTAAAGTCTGCTCTGGGTGGTCTGCGCCTTCTGTGGGTT
CCTGTAAGAAATGTGCGGTCAGTGCACAGGCAGTGTGCTGGGAGTGCGGTGCATTTGCAT
GAGTGTGGACAGAGATGCAGGAGAACTTTGGCTGAGAATGTCTGCCCTGAGCCTTGAGTT
GGATGGTGACTCTGTGTGGTGTTTGTGCAGCCCATTGACACGTGACTGCTGCCCAGCCAT
GTGGCGTGTGATAGTATTTTCCCCTTTCCAATATGTTGCTGATTAAAAGGTGGTTGTCTG
GAAACCCAGATGCCATTTTCCTAGAAAACTGATGTTTCCATCTAGGTTGTTAAGATGAAA
ATGAAGCTGTCAGACATCTATGTGGAAACCTGCGCTGGACCACTTCTGTAACTGACTATT
TCAACATTCTGTTTGATTAGGGTCAGGTAGAATTGATCTTGCTGTTGTCCATGGTGGGGA
GGTTTCTCTTTGTGTTGTTTTATTGAGGGTTAGTAGTCACTGGCCCGTGCATGCAGGGAT
GTTTGACTTAGCCAAATTTGGTGGCCATATTTGCTGAGACATGTGACGATCAGCATGTGG
ATTTGACTCAATGTTTTCCGGGCTGTCCTACTTTCTCAGGTTCCATTTTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAAATGAGTGAAATCTCAACCGTCGTCCTCATCGA
ACTGATGTGTCCAGCACATTATTTCTACAAAGGTCAGGCAGGAGGGGATCACTTTCAGTG
TTTAACTTGGTTGCAACAACTGGATTCTCCACTTGCAGAGGTACAGCTCCCGATGTAAGC
AGTCTCTGCACAGGCGAGGTTCCCAGGGTCTGGGAGACAATTGGGTTCAATGGCTGCTAT
TTGCTGGACTGGGCCTTGTGCATTAGGTCTCTAGGAGTAGGTGAGTGTGCACATGGCACA
GGGTGAGGTAATATGTTGCCAAGATCTCCATGCTCAGTTTGTCCTCATCAGCAGTCTTTA
CATTTTTCCACCTCCTTAGGAAGATTGGTCATTTGTATGGTGAATAGAGCCACAGGCTGG
TCTTGAATGCCATTTGCAGCATTTTCCTGATTGGCAGAGAATATTAGAGTGCTTTTGATC
TGTACAGAAGGAGTGTTTCCTGGGGACACGGACATCCCCCGTGGATGGAAACAGGAGAGG
CCTACCCACTGTGCTTATTTTGAGTCATAGCAGTGACCAAAACTGTAGTCCCACACTGAT
ATTTTTGGCCACTGGTGGATACTGTAGGGAAGAGTGAGAAAGAGCTGTCTGGGCACTGTT
TGGACAGTCTTCCATGTGGATTTGTGACTGAAGTCTTTCCTGGGTATTGGAGCATTCTGC
GGGCCCCTCTGATACATGCCACGTCGGCACAGAAGTGATGTCCCAGGACCGTGGCCTGTG
TGCATGTGAATCGGCGTACATTTACAGTTTTCTCAAAGAGCGCCTTGGTGCTGACCCTTG
AGATGGATGGTTTTTGTGTGATGTCTGCATAGGCCGTGACACATTGTTGTTGTCTGAGCA
TTTTGTTGATATACAGACAATGCTATGTTTTCCTGTTTTGTCCCCTTTTCTCTGTTCTGT
GGGCTGAAAGATATTTTTCTGGACAACTAGATATCATTTCCCCAGAAAACCTACATCTCT
ATCTAGCAGGTTGATGGAAGACGAGGATATCCTTTGGCAGGATGTTGGCCAGCTACATGG
AAATGCACCCTAGAACACTTAAATGATGAGATACCATAGTATCCTCAAGTTATGGGTCAT
GGAGAACAAACAGATCCTGCTGTCGTCCTTGACAGGAAAGTTGCTTTTATTGCCTTGTTC
TAGTGGACGGCTAGTACTTGCAGGCCCACGAATGGAGAAATGTTGGATTTAGTGGCTGAG
TTTGGTGGCAATTTGCTGGAACGTAAGCGATCACAACTTTCCAGCATTAGAAATCATGAT
GTCGTCAGTGTTTTCTGGGCTATACTGCTTTCTCATCTTCCATTCCATAAGAAGCCTGCA
AAGTCCAGGTAATCTGGGACTTGGGTTTCCTGTAAGGGCAAGGCACTGAAGGATAGTGCT
TGGGAATCTGCTGGCAGGAGTAATGAAAGGGCCCTTTGTGCAGAATGGTGTTAAGTACTG
TGTGTCCCCAGTGTACTACCTTGTGGCAGTTGTCTTGTGGGATTGATGACAAGGGTTTTT
GAGCACAGGGTAGAGAAAAGGCAGTATTGCATATTTGGTTTGGCTCCTAGGGTAGGCATC
TGCCTTTTGTCCAGTGTTTCACAGATGCCACCTAAGACAACAGAGTTTGTATTAAGTGTG
TCCTTGGTTTTCAACCTCGTACCTGTGCTTCAGGAAACCTTTTAAAGTAATTAAAGTAAT
TGTGCTACTTGGTATCCAGTTTATGTTGGAGAACATTTGGCAGGAGTTTCTGTCCTTGCA
TGGTCCTCAGGCAATAGAACTTCACCTGCTTCCATCTCTGTAATGGTGTGAGGGACCATG
CTGGTCTCTACTGGTGTCTTTACCGTGCCTGAGCCAAATTGCAGATGTGGGAGCAGTGGT
CTTGAGAGTGTTGTTCATGTGAATAGTATTAGGCTCAATGATGAGGCCTTGAAGCTCATG
TGCATAAAACCAAGTGGCTTGGACAGAGTCACATATACGTAAGCACTTGAAGCCAATATG
AAAATAAGCTATGTGGAACAGGTGATGCAGAACATCTTTATGGTAACTGGTGTTCCTGTC
TCTGTATGAAGCACCTCCATGTTTTCACTGGCTGTTCCAGGTGACTTTCTATGGAATGAA
ACTCTGTCATCTGGAAGAAGCATCTTCCATTAAGACATGACCAGTCATCTCAGAAAGAAC
AAAGCTGGAATATAGAGTCCACCAGATAATATGCACTGCTGTCCATGGTAAGCTGGTGCT
TGGTCAGACTTGCAATTTTTCAAGTGACCAAGAATGGAGAATGTGCACGGATCGATGATG
ACTTCCAAATATACATTCCTTGGAAATCTGAACAAAATGAGTGAGAAATCTCAACCGTCA
TCCTCATCGAACTGAGGTCCTGCACATTATTCCAACACTAGACACAGAAAGACACATTCC
AATATTCAGCTGGATTCTTTGCCTTAAGGATGCGTGGTGCCAGTGGTAGTCTTAGTTTAG
TAGAGAATCCGAGTCAAGGACACATATATGTAAATCACCCTGGGCTCTGACCAGTCCTCG
TGCACAGTGGTGATTGACCACAGCATGTCTTCTCAGTGCGTGGGTATAAGTCTCCACACA
CAGACGGAGTAGTGCCTGGTTTATGGTCCGTGGGAACCAAGGGAAGGTATTGTGTCTCTC
CACAGACACTCCCCACAGGTTTGATGGGCCAGTCTTCTGGGGGACCAACTGTTTATAGAA
GGAGAAGAGTTGGCTGACGTTCCCAACAATACTGGGATTTTACATCTGATGTCTCATTAA
ATATAAGAGTGACTTATAAATGGAAAAAAAGCTACCTTAGGTGGAATCATCCATCCTTTC
ATTTTTCCAACCATTTCTGTCATAGCAGAACACTTATTTTTTGGGAGAAGACCATCCCAT
CAAAAGTCAGCAATCGTGAACACGGGTCACTGATGAGCTCCGTTTCATGTTACCTCTTCA
AATACGCTCACAGGAAATGTGATATATTGCCAATTTAGCTTGAGGTATATTTCATCTGCC
TCATTCATACCAAAATTGACTTCCAGTGTACAGGGGAATATATCCTAGTCTGAATATGTG
ATTATGAATAGTCATTCAAGGTAAACATTTCGACTGATGGTTTCTGAGGAGGAATGCTTG
TAGGTTGCAATAGTCTCTGAGCAAAGTCCATTTTTCTGGATATATGGATAAATTGATGAA
TGCCTAGTAAGAATTTTCATGATCACGTGTAGATCTTTATCATGTCCAATGTATTTCATT
TTACAAATCCCATCTTTTTTCTTATACTCTCAGGATTGTGTATGAGGAAAGTCCACAGAG
TTTGACCATGGAACTGAATAGATGTGGATTCTTTTCATGTCTTGCCAACTCTTGAGATGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved