Tupaia_belangeri Locus Mono:2:SNORD88
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:2:SNORD88
Tupaia_belangeri
Mono:2:SNORD88
scaffold_120533
SNORD88
1001..1089
2089
TTTTCTCCATTTGTTATAGGAGCATGCTCTTGCCAAAAAGGGAGAGGGAAAGAGAGAAA
GTGAGAAATTGACCCCCGCTCAGGATTTTAGGAATGCACACATACCTGAGGTGTCTTTCA
AACAAACAGGTCCAGGATTTCAACACAGTTGACCATGTAGGATCCAGCGCCTTAACCACC
ACACCATCTGCTAGACTATGAGCTTACTTTAAAACAATACTAGTATTAAAAAAGGAAAGA
AAAACAAGAACCACGATTATACTAAACTAACTATAAAATTTGTATCTTTTAATGCTTATT
ATGCTACTATCTATTAAGTTGTCAGGAAAGTCATGATACATTTTTGCATAGAAAAATATG
TTCTGACTTTCCTGATAACCTAGTAGTTTTGGAGTTTTTAAAAAAAATAAATAAATTAAA
ATATGAGACCAGTAGGTGGCATGGTGGTTGAGGCTCCTACATGGCTAACCACGGTTTGAG
TCTTGGACCTGGAGGCTTGCTTTCTCTCTCTCCCCCTTTCTCCAGTAAAAGAACATGTGC
CCTATAGTAAAATACATTTTAAACAGAAATAAATAATTCTTAAAAAAAAAAAAAAAAAAA
AAAAAAGAGAAAACTAAACTAAAATATAAATGGCAAATATATATATTTCCTCAAACAATT
CTATGGACAACTAGTCTTAGAAAAATTTTCAAGTTACTCCTGTGCAAATGTAACAAGTAG
AATACAAAGTAAAAAAGGAGCTATCTTCTCATTTCAAGCACCTTTATTTATCCTGATTCT
GTTGCCTTCCCCTCTGGTCAAATGTGTCTCCCTTTACAAATATTTTGTCTCTTGGAATAA
TAACTAAATAGAAGAGTAACTCTAAATAAACTCATCAAACTTAAGTAGTACAAGCTAAGT
AAACTGTCAATGAAAATTCATCCATAATGATACTGTCAATACCACAGGAGTCATTTGCCA
CTTTATTTTGAATTCTAGGAGGGTTTAAGAATTGCTGACATCCACTCCCACGATGTCCAG
CACTGGGCTGCAATTACCCATGAGGACACAGTGCCTCCCAGGATCTCTGACACCTTGGGG
GTCTGAGGGGCCCCATTTTTTAAAAGAAAAGGGGAAAAGAAAAGAATTGTTAACATCCAA
ACACTAACAAGTAATCTTGTTTTGGTCACTGAGTCCTAAAGAAAATGCAACAAACCCTGA
TACCCTGGACATTGCAGTGCATTGCTCCCTGTTCTTCCCCTTTCCTAAGCTACAGAAAGA
AGAAAGAGAAGAAGAGAATCAAGAAAAGGGATTCTTTACAAAGAGAGAATAAAGCACTTA
CACTTCATAGGACTTTCTAGCCACAGATGCCAGGTGCTACCCACTGAAATCCAGGCTTGG
ACTAAGCTCCACATTTCTCAAAGGACCATCTCAACCGAAGCCTGGGGCTCAGAGTCAGCA
GGAGGAAGCTGCAGCTCCCACTAGCAGCACATTTCAAAGAGGCTGCAACAAGAGAACATT
TTCCATTTAAGCATCTAATTCCAGTCTTCTGTTTCACAAAGCAGTAGCAGAACAAGCCTT
TACATAGTCTTTTCAAAAGATATTTCCATGTCTATGTGATGAATATGAGGCAGGCTATGG
CCTGGCAACCCTTTCACTAACATGCTCTAAGTCCTTCATTATATTTCACAGTGGCTCCTT
AAAGCACTTCCCCCTTTTTTTCCTTTAACGGTGCAGCATTACTCCAGGACTCACTTCTAC
ACCATTTCTATAACTGCCACATCAACTGAAATCACTGAGCAGGCCCTCAACAAAGCCAGC
ACACACCCAGATAGGAGCCTAAGGATTCATTAGCTGCCAAGCAATAAAAGCAGATTGGGG
CTGCTAGTTAATCCTATACAAAACTTCAAATTAAGCAGAATTACTTAAAATGCTTCAATG
AGGACCAAAGAGCTCTGACAAATAGAAAATGAGGTTCTGGAAATACAGATAACTCAATGA
GACTTGAAAGGCAACATAAAGGCATAAGGTTCCTATATTTTAAAAAGCATTTCTACCAGT
CTATGAATTATGTATTTGATAAAAGATGACTTCCAAGGATTTATAGTACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved