Tupaia_belangeri Locus Poly:10:SNORA71
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:10:SNORA71
Tupaia_belangeri
Poly:10:SNORA71
GeneScaffold_3202
SNORA71, SNORA71, SNORA71
1001..1133, 4829..4962, 6676..6808
7808
CTAATATCTTTGTCTTGACAGATATGCATGGTATTCGTGTTGGAAAAAGCAATGTTGTA
CACTGTCAAGACAAATGTGATTAAACGTAAATTAAAATAAAATTTTAAAAAATCAAAAAT
ATTAATTCACCATCTCTCCAGTCTGCCGTCAGGAACACAGGACCTTTGTCTGTTGTCACT
GCCACTGCACAGCCAATCAGGTCCCTCAGGTGCAAACTGATCAGGTCTCTGGTTCAAGAA
CTCCCTCCATTCCCCAATTCCAGCTATTCTAAGAATGAAGCTTCATCCCCTGCCCAACCC
CTGGGATCATGTGGCCCTTACATTCCAGTCTCAGGCCATGACTCAGACATCTCAGGCTGG
CGATGTCCAAGAAAGTATATGGGTAGATATCATTTATTCACTTAACTGTGCCAGCCACTC
AAGTAGGCACTTCGAGTACTAAGGTGAACCAGAGTGCCTACTGGGCGTTTGCAAAAAGAA
CTCCAAACTAAACATAACGCGCGAGCTCATCTAGGAAGAGCTCCTATCAGGGAAGACTGG
CTGTTTTTACAGGGACCAAGGAACAGCTTCAGATAAAACAGAAAAGCAAAGCAAGTGAGG
CAAGTTTACTTCCCAAACCTCAGATGGCTTTGGAAAATCACCCCAGCCCTCTGGAGTGAG
AAGTCGAACTCCACTCCGGCAGGGGGAGCTGGAGGCTGCGCGAGCGGGTTCCGCCTCGCG
GAAGCGCCGCTCTAGGCCGCAGCGCGCGCTTTCAGCGGCCTTTCCGCCGGCGCTGACTGA
GCGGAGGGGTTGTTTGTCGCGTGGCGGCGTTCAGCGTCATCTCCCGAAATCTCCAGACAT
CCCGCAATTCCCACGCCATCCGCTCTGTGTCCGCATGAACCAGCCATCAGGACGCCAAGG
TGAGTGCACTGCGGGGCGCGTGTTCTGTCCTTCTCGCAGTCGGAGGAAACTGACCCGACT
TGCCCACGTGGGTCTCTTCTGACCCCGCTGCCCTTTCCTGCGCCTGCATCCGAAAGTGAT
CCTGGCTTGCTGGTGCCCTGGTCTTTGATAGTGCAGGAAGAGGACTTGTTGAAAGCGTTT
CCCCGTGTTTGGAGCGTCCACCCTGTCCCTTCCGAACCCTGGAGCTTTCCTACACCATCC
ACCTCCTGCCAGCTGGTGCCTGGCATCTGGCGTGTTGAGCCCCTCTTAACGCTGTAAAAT
AAAAAGAATCCTTCCCTGCCTGCTCACCCCTTGCTACACCCGGAAACCCAATCAAACACT
TCTGCAAATTTGACCTGACCTAGTTGCAACATCTGCAAAAACAGTTTTTAACCCGCTTGA
GCAAGCAAAAGCAGGGTCACCACAAACATGCCCTAAAAAAAAGTCTCTTCTCTTACTTCC
CCATTCTTCCGTCCCCTCACCCCACTGACTTCTGTCTATCTAACCTAGACGCCCCTATGA
CCGGGACTTCACTCATTGTTGTGTCTTGCTTGACCGAGAGTGGAGTCCTAGCGCGCTAGA
AATAAAAGCCTTTTGTACTTTACATCAAGATCCGACTTTTGTGGTTGATTGGAGTTGCCG
TTGTACTCCCTGGACAAGAAGTAGGCCCAGCCGGTTGTCCAGTAGAGCCTTTCAACGCCT
GGCCCATTGGTGGTCTCTGTGATGTTGTAGCAAGCGCAGGGGAGGGTGAGGCCCTGCCTC
CGGGGAGGTGGGGTTGGAGCCGCAGCTGGGTCACCCTTTTCTCCCCAGCCCCTCTGTACT
AGGCACACCCTATGGCAGCTGTCGTCTTTTTGCCTGCCTCTGCTGTGACCTGAAGGGCAG
TGTTTTGCCCAGTGCCTGGCTTCAGGCAGTTCCTTCCATTCCTTGGTATGCAGGCAGCGG
GATGTTTGAATTAAAAGTGGGGGGGTTGGGGCCACCAGGTTAGGTGGTTGAAGGTCTGGA
CTCCCACATGGCAGACCACTTCCCAAACCAATGTCTTGACATGCTGGGTGCGTGTGCATG
CGTGCCCAAGAGCCTGGGAGGAGACGAGAAGGGATTGCTGTGTGGCCATCCTCTGTGGGG
GGTGGTTTCTCACTTTATCTCAACTCGTCTCTTTCTCTGTCTCTAGCAAGTGCTGGTGCC
TTATAGCAACAATCTCTTTAAAAAAGTGGGAAGGATTTTGGTACGAAATGCGCTTGTACC
AGGTCTCAGTCACTCCACTGCTACCTCCTGGTTTGGGGACCTCCTTTGTCCTTGGTGCCC
TCATCTAGAAAACAGGAGTACACTGAGGCGTCTAGTGACCACGTGAGCGGTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAT
GGGAAACAAGAAGGGGGCGGGCGGGGGGTTGTCACTTCATTGTAAGGAAAGGGTTCTTTG
CATTGTGGAGTGGCAGGGAGAATCCTGTGAGTACCTGTCCGAAGGGGTGGGGGAGCTGAT
TTAATGTTTACCTCCCCTTCGAAGGGCTAGCTCGGTGACCTGGACCCCACTTCCACAGGG
CCGGCTACAGTTCGAGTCCTGGCCCCTGTGGTTTGAAAGACACACCTTATGCATTTGTGT
GCATGCCCCAAATCCTGACAGGATAGAGGAAGAAGGGATTGTGGTTTGACCAGCTCCATT
GAAGGGTGCTTTCCCCTTTCCCTCTCTGTCAAGTGCATGTGCTCTTTGGCAGCTAAGAAA
AAAATTCAACAAGTGACCCCATTCTGCCATCAGGGTTGGCCATGTGTGGCCACTGCAGAA
GGGTTTTTTCCTCTCCAGCCTGTGGGTTTGGTGGCAGGGCAGAATAGCAGTGAGGAGTTT
CTGGAAGCAGGCGTTACCCGGCCTTCCTGCTACCCCGTTCCCTCTCCAGGTCCCTGGCCG
AACACCGCAACCTTTCAAGGAACCACAGCCTCAGCATCCCTTTGAATGTAACTCTTAGTG
ACTGTCGTCATGGCGGGTGAAATGGATGTGTCGTCCGTACCATAGAAGATCTCCAAACCT
TCTCCCGGAGGTAAGCTGCTTTCCTTGTTCAGAGGAAAAATTCCTGTGGCTATTCAGGTG
GTGCCAGTCATAGTTTAAGTCGACATTACTGCAAGATGGTGTACAAAAAGGCTTGGTGGA
AACATCACACCACGGGGCCTGAGGCAAGAGGAGGGTGACTACCCACTGGTCTTCAGATCC
AGATCCTACCGCCCAAGTCCCCTTGCCTCCCAGGAACCTAGACCTTACCTGGCTTTGGCT
TTAGGGACCTGCCTGGGTAGAGAGCTCTGGACTTTCCCCAGTTGAATCAGCAGTGGCAGC
AGATCGGCATGGGTGGTAAGTGGGGTTAGGCACCAGATGCACACACACACACCTGCCTCT
TTCCTCTTTGGCCACCAGCTGGCTCCAGTCATTCCCTTCCTAGGAGTTCTCAGTGGTTAG
ATTTGTCATAACAGTGTGGTGAGGAAACAGCCAACTTTGAGGGAGGAAAGATGCAGGCTA
AGTCCCGGCGTCCCGGTGTGCAGACTTTCTCTCGTACTCCACCCCCACTCTCCCAGTCAC
AGGGAACCTGGCAACAAGCATGCATTCCCCTGTGTGCAGTGTTTCTGCCTGGGGAAGCCC
TTTAGAGACTCAGTGCCCTGGGTTTTCACTGGGGCTGGTCATGTGCACACATCCACCTAG
CATGTACCCAGATCCCAGACTCCCAGGAGAAAGCAGGTGTTTGCCTTCCCCATGTTGTTT
GCAGGGTCTTGGCTCAGCGTGCCGCACCAATCAGTGAACTGTCAGGTTCCCAGACTCCAG
TCTAGGGCTGATCTGACCTGTCCTGAACCTCAGTTCCTGGTGTGGAAAACAAGGCTGTGA
CAAGTGGTTTTATGGATTTGACTATGTGACCCTGATCTCTAGCCCCCAGACTTTTCCAGT
GACTAATCAGAAGGGTTTCCCCTTCGATCTCCCTTGGTGGTCAGATTTTCTGGCATTCTG
CAGGTGTGCCCTGCTCTCCCTGGCTTGGGCATTTTCCCTGGCTCCTGGCATCCACCTCCT
GTCCTGCCTCTGCCTCTGCCCTGTTCTGCCCCTGCATTCGAAAGTGATCGTGGGCTGCCT
GTGCCCTGGTCATTGATAGTGCAGGGAGAGAAATCGCTGAAAGACGTTTCCCCGTGTTTG
GAGGGTCTACGCTGTCCCTTTCAAACCCTGGAGCTTTCCCACACCCGTTTCTCTCTGCCA
GCTATTTAGGAACGTACTTTCTGGGCTGTCACATGAGAGTCAGTGTGCTTCGCTTTGTTT
CCAGAAAGGTGTCTGTTCAGGGTTAAACGTCTGGGATTGTTGAGGAGGGCTCAGGTTGCA
GCGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGAAGAGAAGA
AGGGACAGTGCTCCTTGAAAGAGGGGAAATACCGCCTGGCTCTGAGATGTGAAATGCTTC
CCAGCCTGACCAGCTCCTCACATGCCTTCACGGCCCTTTGAACTATGCACCGGCACCACC
CACTGGCCACTGTTCCTGCTTTTCGTTTGTCTGCTGTTTGTCTTGGCTTTCTGGGCTTCC
CTTAGAATGACTGGTTCTTGGGCTGTCCCTGGAGGAATGGGTGAAGCCATCTAAGGTCAA
GAGGAAACCAGCAGGGACAGGGTAGTGGCGCAGTGTAAAATGCAGTGCTGTGCGAGGCCA
GGCACACAGAGTTCTGGGCGTATGTGGGGACCTCCCTGAGCCTGCAGGGCAGGGCACGCT
CACACTCCTGGGCTGGGCTGGGCTGGGCTGAGGCTGTAGGCAGATCGTGGTGTCAAGACC
CTGTTGGGGGGGAGTCTCTCTCTCTCTCATGCACTCATGGAAGCAATAAACTTTTAAAAA
GAAATAAAAAGAAACAGGAGAGCGAGAACCAAAGGGAAGTCATTGATGTGGCATCCTCTA
GCCCTCCCCCCCCCCATGAGAGATGTTTTCTTTATCCTGAAGAACACCTTAGGTTTTTGA
ATATGTTAAAAAAAATGATGGATATGGCTTGTTGCTGCAGGATTTCCAGCTGACCTCTGT
CCTGTGTGCCCAGCGGCCCTGTGGGAGGAATCATCCAGAAGAGATGACCGTGAAGCTTGT
CAGGTATCAATCCTGGGTGTTTCTCTAGAGGGTACACTGCAAGGCCAAAGGTCTGGAGGC
CACAGGAGGGGAGGCAGAGGCTGTTTCCCATGATTTGCTCTCCCACTGAGGCCACCAGGA
CCATGTGGCCCTGTAGGACTTCTCAGCGTGAAGCACAGTAGGTACCTACAGAATCCCCTA
TGCTTCTGAGAGCTCTGGGGAGGCCACTGCCCCTCGTCCTAGTTTGGATTGCAAGTAGCT
TGTTGAAACAAGGGCTGTCTTTCGGAGGCAGGTATTTACCTGAGTGCTGGTCTCTGACGT
GGTGGGAGCACGTGGTCTGAAAATGATGTACGGATAGTGTCACATAGTCCCAGGCGTCCC
ATCCTAATGAATTCTCAGCATTTCTCCAGAAGTCGGTCTTCCCTCCGATTCTCTTAGCAG
GGAAGCATTAAAGCAGTGCCTCTCAAACTGTGGTCCCTGAACTAAGTACCTACAGCGTTA
CCTGGGGGGCTTGTGAGAAATGCAGGACTTAGGCCCTATGCCAGACCTACTGAATGGGCA
GTTGGGGCCCGCAGTCTGGTTCACCAGGCTCTCTCTTGCTAAAGTTTGTAAAGCACCATG
TTAGAGAACCAGCCACTGCAATTAGAGGCTGGAAATCTGGCCACCAGTGCATCTCCTGGT
CTCTTGTCCTGTCTTGGGCTCTTTCCTGGCTGCCAGCAGTGGCCTCCCTTCTTGGCACAG
CCTCTGCCCTGTTCTGCCCTGTATTCGAAAGTGACCCTGGGCTGCCTGTGCCCTTGTCAT
TGATAGTGCAGGGAGAGGACTTGCTGAAAGCGTTTCCCCGTGTTTGGAGGGTCCACCCTG
TCCCTTCCGAACCCTGAAGCTTTCGTACATGTCCTCCCTTTAGTCCCCCTTCTGCCCAGC
ATGGGCATGGTACTCGCAGATTTAACAATGGAGGTGGTGAGGCAGGGCCCTGTCTCAGGG
AGTTTGTGTTGATGGACTGATTTTTTTAGAGCCATGAATAGGATCAGCCTCCTGGGGTGC
CTTCCCATTGCGCCCCCTGGGTGTCAGCACTGATCACACCTGGGGTCCTTGGCTTGCTTA
CCACGACCCTGTGCTGTGAGCTTGCGGGCAGGGCCTCTGTCTTGTTCCATGGCCTTCCTG
GTGCCCAACACAGCACTGGACACAAATGAGAAGACCTAGTACAGTGGTAAGGCTCATTCC
ATTGTGTTTTTTAAAAGGCTGCCTGTATTTCCCTCCATTCCTCACCCCATGCCTGGCCGT
CTACACCTCTGGGTGTAGGGTCACGTGGATTGAGTCAGGTCACTGGTGTAAGGTCCTCAA
GCGATGACGGTATTTTCTCCTTGATCTTTCAAATGGGCCCAGCAGTCTTTAGACTGAGGC
ACCCAGCAGGGCTTGCCAGAGGTCTGTCTTCCATTTCCTTCCTTGGCCAGATCAGACTGA
GTGGATCTTTGCAAAGCAGATGACAGCTTCGGGGGCCGTGGGACAGGCTGAGCAGACAAG
TGCTAATATCTCGGGGGAGAGCTGCTGGGAGGTGGTCCACCACCCCTTTGATCACAGTGC
AGTGGAACCTCCATGTCAGAGCCCCTAGAGTGAGCTCCTGTGTCTTCTCATGGGTTGCTC
TGTCTGGTTAATCACCCTGCCATGAACTCTTTGGAAAATTGAAAAAATTGGGAAAACTGA
ACTTTTAAGATACTCCTCCTCTTGCCTTTTCTCTTGAGAATCCTAACTTGCACATAGATA
GGAACGTAGGCCTTGTTGATGGGAACTTCTCAGTGCTATCAGCTGGATACTAAATTCTTT
GTTTGCTTCCTCGCCCTCCTAGGGCTCAGTCTGAGATCCCAGAGACTGCAGAAGGAGGTC
CCCAGGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved