Tupaia_belangeri Locus Poly:16:SNORA25
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:16:SNORA25
Tupaia_belangeri
Poly:16:SNORA25
GeneScaffold_4039
SNORA40, SNORA18, SNORA8, SNORA1, SNORA32, SNORA25
1001..1126, 2042..2172, 3191..3328, 3544..3675, 5602..5730, 5977..6107
7107
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAAATCTTTAAATCACTGCCAACTAAGCATCTTCTTGAGGGTCCTTGAAATGCACTAT
TTTAATGTAAACGTTTATTAAAAGTGACTCTTCCACTAACAGATATTTAGTATTATAGTA
ACTTAATTTTCCTTTGCAAACAACGTGGGATACTTATTTTAAATTTTAAAAAATTTGCCA
TAGGACCTGTGCTATCCAAAGCAACCACCAGGGTAGATGTCCACACCAACCATCCCTTCT
CCTCTAGGGGTTTTGGTGTATGCATGCACACAGGCCTGTGCCTCTGAGATATCAGGTCTG
GGACACAGATCAGATGGCACTGGGATCCAGTCATTTTAACACCACATCACCAGTTGGCCC
AATACCTGGAACTTTTCTAATATTGACATTCAGTTGCCATTTTGTGATGCTGATAATCAT
GGTTTAACTGAATAATCTGATAAACATCAGCATTTTATTTTAGCACTTGAATTTGTTTTT
GTCTGTCTTTTAGACAAAGACACAGAAAAGTGCAAAAAATAAATCCTCTTTTGCAACCCA
AAACTCATTGTTTAGTATGAGTTTTGATACATATAAGAAGGAATATTACTGCTCAAGACA
GTTAAAAGTGATAGGATCATTCATATCAATAAAAGTTGGATCCAGAAATGATTCATGGTT
TAATAATTAAAAAGCATTGGACATGAGGAAAATCTCAATCATATTCTATCTAATTCATAA
GTTGACAGGATATATTAAGATTGTTCTTTTTATTTATTTTTAAGGCTTTTATCTTGAAAA
TGTCGAGAATTAAAGGTATGTATTTAAATGTCAGCTTAAACCTCCACAGGCTTTCTTTTG
TTTTAAAGAATTATTTAACCTTATTTTTTGTTTTTAATTTGGACAAAGAGGGACAGAATA
AGAGAAAGTGGCAAAGCAGGCCAGCTGCCAAGCCTAGGACTCAAACCGCCATGTGGGAGT
CTAGTGTCCCCAACATTACACCCACTGCCAATCCCCANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTAATGGCTATGTCGCTGGACTCCCACGTAGTCGACCGCGGTTC
TTGTCCCGGACCCGGTGGCTTAGAACTCACGCCGGGCGCGTGTGCGTGCGTGCCCAGGAT
CCCGAGAGGAGAATGGAGGAGAAGGGATTGCGGCGTGACCATCCCCCCTGGGGGGTGATT
TCTCGCTTTCTGTCTCTATGTCTCTCTCTGTCTGTCTGGCGAGCGCACGCGCCCTATAGC
GAAAATCTCTCCAAAAAAAAAAAAAAAAATGACTGCTTTATTTTTGGGATTAAAATGGGA
GATTCTTTTTAACTGTTTCCTTTTTTGTATAATTTCATAATTTAAAGCTGAAAGTCTTGA
TAGTCCTTGCTAGTAATCGCTGTCCTTTGGGTCTTTACACATTTTGGAATTTGCATGCAG
TGGTTGAGGTCTATCCCGATGTGGCTTTTCCTGTAGCTGCACATCGTTGGAAACGCCTCA
TAGAGTAACAGTGTGGTTTGCTTTACTCACAGGACTATTTGTTAATTCTGTGAGAAAGAA
CTACATTACAGAATGACTAAAAGTATGAAAGATCTCATAATCATTTTTTTATCCAGGTAT
TACTACATCCCACAGATGTTGAGGTAAGTTTGAATTGGTGACATTGTAGTCTTTTGGGAA
TCCAACTATAGCTCAGATGATGAATTTAACTGTTCAACTGCTGAATGATGCAGACATGAA
CTAAAACTTAATTCTGACAGTGGGATGTTTGCATTTAAATTTAGGGTTTCACATTTGTAA
TAACAAAATGATCATGTCTTTCCAAATTGTGTGGTAATTTTTCTGTAGGAACAAGTCTGA
ATTGATTTCCTGTGTAGAGGTAAGTGACATATTTATGAAGGAATCAAGCTATGATAAATT
GAGTATAGCCTACTAATATTTTTATAACTAGGAGTTATTTTAGATATAAAACAATTAGTA
AGACCTTCACAAAAATAAAGTGCTACAGTACATGTATACATAGCAAACATTGAAGACCGT
ATGTCCAAGCCCACCAAGTGACACTGCTTTTGTTTTTTTGCATGCTTTGTTCAAGTTCTG
GCTCCCATAGTTCATCCTAATACCATGTGTATTTGGATATATTGATTTAGGAGAGATACT
GCATCATCACTTTGAAGAAATTTTTACCTAAGTTGGCGATTTTAGCAATAGTGATCTGGA
CATTTCCAGTTACGGCAACTATATTTATATTGTGACTAGGATTATAGTTGAAGTTAATAT
GATTTCCTCACTAGAGTGCCAATATCAAATTATGTTTAAGTTTTTTCTTTTTTAAATTCA
TTCTTTCATTTATTTTAATTTGACCAGAGAGGGACATAGAGAGAGGGAAAGGAAGAAAGA
AAGCCGCCAGGCCCAGGACTTGAACTGTGGTCAGCCTTGAGGGAGTATCCAGCCCTAACC
ACCATGCACCTGCTGGTCCCCATGTGCAATATTTTTAGACCTGGTGTATGGGTACTTGAG
TTTTAGAGGTTTGTGAAAGTTTCTGAGTGACAACAATGCAGCCTTGAGAAGACTATGTAG
AGCTCAGTCATTGCACTGCATGGTATCTGCACTCAGCAGGTTATTTCTGCTGCAGTGTTC
AAAGGACAGTGCCACAGAAATTCAGTATCTGGCATCGTTGGTTTTCTTGGCTTTGTGCAT
GTTAAACCTGGTATTCTATTGATACAGTACTTTTGTAGTTTCTCAATACTAGTTTGCTTA
TAGTCTCAGGAGTAAGTCACTTACTCTCTCTTTTTCTAGGGTGTCATTTTGAAAACCAGG
CACATGCAGCCATGCTAAAAGTGTAAGGCTTTCTGTTTATCTTGCTTTTTTATAACATTG
CCAGCAAGCATTGATGTAAAAACATGCTTCTACTATGCATGTATCTCCTGAGGAACTTTC
ATAAAGCCTCATTCTAGTTTCAATTGGACACTGTGGATCAGTGTCCAAAATTGTTAATGT
GGCTAAATTGAGACACAGGCTATGCTTCCATCACAGTAAACGTATTACAGTGGTGACAAT
GAGACCTGTAACATTTTGCTAATTTCGTATGTCAAAGCACGCAACAAATACTGAACTAGT
ATTAGAAACAATTAAGGAGAAAATAATATGATAATTTGCCAACATTAGTACTTATTTTCT
ACAATTCAACTTTTAGGGCCCGAAGTCAATTATTTAAAGAAATTGGATCCCAATATTCCT
GGGTAAGATTTAATTACATTGAAGGCAATTGCAGATATTTTGTTAAAAACAATTTCTTAA
AGATGCTTTTGCATTGGTGTGTGTGAACTTGCCAGCAAGTGAGAAATCCCCCTAACCCCG
GAGGGGTTGAGATAGGAGACAGGGACCCTATAAATATAGTTAGGATATGGGCCCAAGATG
GGAGTCACAAAATGGCTATGTTTTAAGATGGAAACAGTGATGGCTCAGTGATTGACCTAG
ATCTAAAACAGCTTTTTCCAAGCCTCACCACATTCAAGGAAGAAGAGAAGATAATGGTTT
TAATTGACTCAAAGCTTCAAGACAGTCTCCGAACCTTCAAAATTAGGAAAATATTTGGAC
CCATACAGCATGTGTCCCTACCAGGAGCAGAATGCATGCACAAGCCTCACCTAGAACCTA
GGTCTGAACAAAGCCCTTCCTGACCCAAATGAAAACCTCTTGCCGAGACCATCAGTGACT
GTAGTGGCTATGTCGCTGGACTCCCACGTAGTCGACCGCAGTTCGTGTCCCAGATCTGGT
GGCTTAAAACTCACACCAGGCACGTGTGCGTGCGTGCGTGCCCGCCCAAGATCCCGAGAG
GAGAATGGAGGAGAAGGGATTGCGGCATGACCATCCCCCTTGGGAGGTGATTTCTTGCTT
TTTATCTCTGTCTTTCTGGCGAGCACACGTGCCCTATAGCAAAACTCAAAAAAAAAACAC
CTAGAGGATAGATTTCCGGGACCCCCTCCCTTCTTAGGAGCTCTGTTTACCCTTCCCTCT
CCTTTAATAAATTCCGTTTTGATAATTTCCCCACTTTGCTAATAAACTCCCCCTTTGCTA
TACCTAATCTGTGTCCTCAGCTAATTCTTTGAACATGGGACAAGAACCCATATTTCACTG
AGTGCGGACCTGATCAGCCCTGTGCTCCTGTGCATCAGTATGGCTGCGTCCCAATCCCTT
TGCCATTCTCCTGTAATTTGGAGCATGCACGCCCATTTACCTGGTGTGACTCAAGCTGCA
AGGTCCAGGACTTGAACCATGGTCAACCATGTGGGAGTCCAGCGCCTTAACCACTAAGCC
ACGAAACTTAGACCAGCATTAGTTTTTACCTAATAATCTATTGCAACCAAACCCAGTTGA
TTTTATTCTGTCAGTATATGATTTCACTTATAAATGATGTTATGATGATTGGCAAAATGT
TCAACTGCTCTGAGTGGGCTGAGTGAAAATAGCCTTTCTGAACATCCATATACATTAGCT
ATATTTGAGAATACTATAAAAGATTTCTAAGGTAAAGTTCACCCGAAGTGCACGCTTCAA
AATGGCTGTCTTAAGAGCATTTAAAATTATACAGAGCTTCAAAAAGTTGGTGGAAAAATT
TACTTCCAAGTAGGAGATTTGTCAACAGATGCTTAAAATCAGTGTAGATGGCAATGGAAA
TAGGGTATTAATTTAAATAAGTGGGATTGAAGCACATAAATAACTGTCAAAATTCAACTC
TGGAATTTTCAATAGTTGAACATTGGGGTTTTGTATACTTTGGAACCTAAGGAAACATTT
TTTGTTTGTTAAGCAAAGTCAAATGTAGTTCTTTTTTGTATTTCATGAAAAATCTGAATT
TGAAATATGAATTTTTCCATAGGTGGACAGACGTTGAAGTCACCAGTATGTCCATAGTTC
TAATGGAGAACAAGAAAGACATGAAAAAATTGTGGCAAGTAATCATTTTCCTGTTAACCC
AAGATATTTGCCATGGTATGAATGGTCATTACCAAGGCTTATGGAATGCAGTTCCTCATT
TGCTGTGGACATGACCATAAAGAAATTTCCCACTAGGTTTTCTATCTGCTACATTGTTAT
GTTGCTAGAAATCAGCCTATTGGGAACATTTTATTTTTTAACCTATTAGGAAATCTGTAT
TATCCAGTAGAAATAGTCAGATGCCATTTCCCTTCCACCAGGAATGGGACTTAGGGGGAG
CTAAGAGGAGGAGGCTGGTGCTAGTACTTTTTACATGGTCATTCATACCTGGTCATTAAA
ACTAACCTATTTATCATTATGTAGGTAGGGCTGACAGGACAACTATGAATTAAGTACCAG
TTCTTTTAAAAAGGTATGTACACATAAGAGACATATAGGGTCATTTCAAAGAGGGCTCCT
GAGGCTATAAAACCAGGAGCTCTTACGCAGTGACCGAAGACTGAAGTTCTCTATAGGATG
CCATAGTTGCTCAGTAATAGCACTATGTTTTCCTGGGGAGATACAAGACTAATTAATAAT
CATGACTGGTTAAGTGTGAGCATCTCAGTGTTAACGAATGTCTTTCTTGTCTTTTCTGTA
GGACTATCTTGACTTGGGCCTTGGAGGAACGAAGGTGGTTGTGTCCTTGGTGAGCAGCAG
AAGGAATCAGAAATTCAGATATTCCTTAAATAAGAATTTATTGACTCTTAAATAATTTTG
CTTATATACATAAAAAAACCCTCAAAATCAGCATGTACTTTTGTTTTTGGCTCGAAGTTT
TTCTAGTGTTTTCTGTGGAAAAAAATAAAAATTTGTTACAATTGGTTCATCTTAGCCTGG
ATCAAGTTGACTTGAGAATGGGGACATTTGTTTCACCTTATGAAATTCTTTTGCCCTTGC
TCTGTTTTGGGCGTAAGCTTCTTGCTTGGCTTTCTCTTCCTTTTGCTGTTTCACTTCAGT
TAATTGATTATACAATCTATGATAAATTTAACTAGAGTTACAGATGAACATTTCAGAAGA
ATGAATTGTGAAAATACTAAAAGGAAAATTACCTCAGAGCCCTTTGGTGCATGACGGTTT
GTGCCGTCTTTCTGTCTTCAGGAAGGGACACTCTAATTTTATTTGTACCCTTTAGGCAAC
TTACAGATGAACCTGAGAAAATGAACTTCTTTGAAACTACAATCAGAGGTTCAAGATTTA
GCTGTTAGTGGAAGTTGGATTTTTCAAACATACCTGTAGATGGTGTAACTGCTTGTAATT
GAGAATTTTCAGAGACACGTGCTTTATTCCTTATTTCTTTCTGCCTCTGGGCTGATCTCA
CTATAAACGACTTTTTTCTCTTTATAAATGCTTCTTGTAAGCTCCCTGGTGTATCTGTAA
GCTTTGGAAGCGTTTCTATTACAACAAAAAGAACACATGCAGCTTTGTGTGTGGAGGGTG
ATAACTTTGGCATGGGGAGCTTGTTCACAAGGTATAAGGCATACAGACCTGTGGATGTTG
TCATTGTCTTCTCCGTATCTAATTCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved