Tupaia_belangeri Locus Mono:167:SNORA7
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:167:SNORA7
Tupaia_belangeri
Mono:167:SNORA7
GeneScaffold_776
SNORA7
1001..1119
2119
TCCATTCTCCTCTCGAGATCTTGGGTACGCATGCACACGCGCCCAGAATGAGTTTAAGC
CACTAGGTCCGGGACTCAAACCGCGGTCAACTACATGGGAGTCCAATGACATAGCCATTA
CACCAACTGCTGGCCCCAGCATATAACTAAACTTAAACCAATCAACTACCATACAAAACT
CATAGAGAGGTGCTAGAAAAAGGGTGTGTGTGTGTGTGTATCTTGTCTATGCTAAAGGAG
CATTTCAAAGCAATAGGAAAAGATGAATTATCGGGACCAACAGGTGGTGTAATGGTTTCA
TTACTGGACTCCCACATGACCAACTGCAGTTCGAGTCCCGGACCTGGAGGCTTGAGACTC
ACACCTGGCATATGCGTGTATGAGCCCAAAATCCCAAGAGGAGAAGGGATTGTGGCATGG
CCATCCTCCCTGGGGGGTGACTTCTCACTTTCTGTCTCTCTGTCTCAGGCTCTCTGGTGA
ACACACATGCCCTATAGCAAAAATCTGTCTCTCTCTCAAAAAAAAAAGATGAATTACTAA
TAGTATCATAACACAGGGGTGGCCATATTGAAAAATAAGAAAGTGGAATACCTACTTTTT
TTCTTTTTCTTTCTTCTTTCTTTCTCTCTTTCTCTCTTTCTTTCTTTCTTTCTTTCTTTC
TTTCTTTTTTTCTTTCTTTCTTTCTTTCTTTCTTTTCTTTTTGCTAGAGGGCGTGTTTAC
TCATTGGAGAACGTCAGAGACACAGAGAGAATGAGAGAGGAAAAATCACCCCTCATGGGG
AATGGTCATACCACAATCCTTCCTTCTCCATCCCTCCTTTAGGGATTTTGGGCACACACA
CACACGCCTGGTGTGTCTCCCAAGTTGCCATGGTCCAGGACGCCAACCATGTGGTCGGCC
ATGTGGGATCCAGTTGCCCTGACCACCAGGCCACAGAGCTGACCCCAGCTGTCTTTACAC
CAAATCCCACCTGGATCGAAGATTTGGGAAATACAGAGTAACTCCTCCTGGGATTGTGTC
TGAAGCGTGGCTAGTGTTCTGCCAGCTTTGGAAAGAGGAAGGAGAGCGATCCTGCCAGTT
TGCACAAGAGCTGGCAACTGGAAGACACTCTGCAACCGTGCCAAGAGAAAGAGAAAGAAA
GAAAGAGAAACAGAAAGAAATACTGCATTGTCAGCAAAGCCATGATGCATTTTTGCATAA
AAGCACATAGAAAATACGTTCTGACTTTTCCAACGACCTAAAATAAAAAGGGTGCGGACC
ACGTACATCCGTTTATGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
ATGCGTGCCAAGATCCCGAGAGAGAATGGAGGAGAAGGGATTGCGGCGTGCCCATTCCCC
CGGGGGGTGTTTCTCGCTGTCTCTATGTCTCTCCCTGTCTGTCTGGTGAGCGCACGTGCC
GTATAGCAAAACCTCTCCAGAAAAAAAAAAAAAAAAGAAAAAGAAAAAGAAAAAGAGGGG
CCACCAGGTGGTGTTGAGGTTGCATCGCTGGACACCCACAAGGTCACCGTGATTCGAGTC
TGGGACCCAGAGGCTTAAAAAAATCACACCAGCACGTGTGTGGACGTGCCCAAGATCCCA
GGAGGAAAATGGAAGAGAAGGGATTGTGGTGTGGCCATCTCCCCTGAAGGGTGATTTCTC
ACTTTCCCTCTCAATGTATGTCCGTCTCTCTCTCTCTCTCTGGCAAATGCACGGGCCCTA
AGGCAAAAACCTCTTTAAAAAAATAAACTAATAAATAAAATAAAATAAAAATAAACACAC
ACACAGGCTCTAGCAAGGGCACAGCAGTGGCACGAGGCCCTGTGATGCGAGGCCTCATGA
AAGACTGGGTTGACTTGTTCCTACTGGGTGGGTGTGGGCCGGAGATCCTAACTGGTGGGG
AAGGAAGAGGGCGGAGAGTTTTGGCGGGAGTCCCTATGGAAGACTGTCTCTCTCTGCCAT
TCTCACAAAACGAAGCCACAGGCCAGTAGGTGGCGTGCTGGGTAAGGTACTGAGTCTCAT
ATGGCCGGTTGTGTGGGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved