Tupaia_belangeri Locus Mono:74:SNORA30
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:74:SNORA30
Tupaia_belangeri
Mono:74:SNORA30
scaffold_89903
SNORA30
1001..1128
2128
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGAGTCAGAAAGTAAGCCAGGTTCGGGACTTGAACCATGGTCGACCATGTGGGAGCC
CAGCACCTCAATCACCACATCACCTGCCGACCCCTACAATCTAGTCTCTTAATAGAGTTG
TCTTGAACATTTCAGAAGCATTTATTGAAATAGTAAACTTCTTAGCACTTTCAGGGGTCC
TCACTTACGCAGTGAGGCTAGAGTACATGGCTGGTGCTGAGAGAAAACTCTTGATTATGT
CCTTGCCCAGGGACTCTATCATTGTCACCCATCAGTCAATGGGACAGAGGGGAAAAAGAA
AGTAAACTACATGGGCCAGCACCATGGCCTGATGGTTTAGTGAGCCAGATCTCACATGGC
TGACCACACGGTTCAAATCCCAGCCCTGGCTAGTTGAAAAATATGTGGGGACGGGGGGGG
GGGGAGGTGGGGAGGTGGTGTGGTGGTTAAGGGCGCTGATCTCCCACGTGGTTGACAGCA
GTGGGAGTCACAGACTTGGTGGCTTGCTTTCTCACTTTCCCTCCCTCTCTCTCTTTCTCT
CTCTCTCTCACTCAATCCCTCTCTGGTCAAATAAAAATATATAATTAAATAATTCTTAAA
AAAAAAAAGTTAGTGGAAAAAAAAGAAAATATGGTCTATACAGACACTCTGGCATACTAT
TCAGTCATTTCAAAAAAATGAAATCCTCTCATTTGACATGAAGTGGACAAGCCCGGAGGC
CATGACACTAAGTGAAATAAACCAGGCACAGAAACAGAAATACCACGTGTTCTCCCTCCT
TGGTGAAAATGGAAAAACATGGGCTCCTAGAGGTGGTGGGACGAGGAATGACTGCTACAG
GCTGGGAAGGATGGGAGTGGGTGACCGAGGGATGTTGATTAACAGAAAAAGAAACTGCAG
GTAGATAGGGGGAACAATTTCTAGTGTTAGAAGATAATAGTGGAGAGGACGCAGATGACA
AGTTGCCTGTTATCTCAAAGTTACTAAAAGGGAGGATTCTGAACATTCCCAACAGGACTG
AGGACGAAGGTTCAGATGATGGCTATGCTAATAACTCTCCAGGAATCATTACACCTTATA
TTCGCGTACTGAAAAATCCCATCATACTCTCACGGATATGTACAATTATTGGGACCAGCA
GACAGTGTAAAAGTTATGTTGCTGGACTCCCACATGGTCGACTGTGGTTCAAGTCCTGGA
CCCAGCAGCTTGAAACTTACCCTGGGAGCACGTATATGCCCAAAATCCAGAGAGGAGAAT
GAAGGAGAAGGGATTGCTGCATGCCCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved