Tupaia_belangeri Locus Mono:28:SNORD77
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:28:SNORD77
Tupaia_belangeri
Mono:28:SNORD77
scaffold_142320
SNORD77
1001..1068
2068
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGCA
TTTAGGAATAGAGGTTAGATAGTAAACAAGTAGATTAAATAAACAACTAGTTTTTGAAAG
TGATAACTGTTATGAAGGAAGCAGACCTTCTGTGCCAGAAAGGAATAGTGTCACACTATC
TATGTGACCTGTGTCTTCAGGAAGCTCTCTCAGAGGTGATGGGTTGTTTGAGCCCTGAAG
CTGTGAACCCAGTAAGGGAATGTCTTGGGGAAGAAGAAAGTGCGAGTGAAAGACTAAGGG
CTGGGACCAGTATATGGCATAGTGGTTACATTGCTGGACTCCCACATGGCTGACTGCAGT
TCAAGTCCCTGACTCAGCGGCTTCAAACTCACACCTGGTGAGTGTGTGTGCATGCCCAAA
ATCCTGAGAGGAGACTGGAGGAGAACGGATTGTGGCATGGCCAACTTTCCTGGTGGGTGA
TTTCTCATTTTCTGTTCTTTGACAAGTCCATGCACCCAATAACAAAGATCTCTCTAAAAA
TAAAAGACTAAGGATTTGGAGGGAGAAGGGAGCCCATTGTGACTGGGGCATCAAAGGAGT
GGGAGGAGAGTGTATGGGACAAGATAATGGATATGGATATGGGCTGAATATACTAGTCTG
TGAGTGACAATAACGGCTTAGAATAAAATTAAAATTGCAATCTGATGATGGGAAAGCAAT
GGATACTTTAAAAAAATTGTCATAACCAGTATACAATAAGCTACACATATATGAAGAGCA
AAAGTTTAGGCCCAATTATGGTGGTGAACACTGGTATGACGCTGCTTCTTCACTGGTTAA
AGCCCAGGTTTGATTCCTGGCCTACTCTAAGAGCCAGGCATGTACTATGTTGGCTGCATA
GTTCAGCAGATTGAATCTTGAAGGAATCTACCAGCTGTCTGATGTTAAAAAAAAGAAAAA
AATGAAAAACCAGATGTGGTGGTGCTCCCCTGTAGTTCCAGCTACTCAGAAGGTTGAAGC
AGGAAGATCACAACAGAGCAAGTCTTTATCTTGAAAAACAAAATGAGTACAATGCTATGT
TTTTACATATGCATACACACCCATAAAACCATTTCCACAATACGGTAATGATCTTCATGA
TGCTTTATAATCCTTGTCTTCCTCCAGCCCTCCTCCCCTTGACCTTCTACCCACACAGGG
TTACCACTGATCTGATTTCTGTCACTGTACATTTGTTTACTTTTAAAAGAACTTTCCATA
AAGGCAATCATACAGTATTTTCGTCCACTTTTTGCTGCTAATAACAGAAATATCGAAATC
AGTTTTCCATGTATGTGGGAGTCTATTTCTGCACTTATCTGGTTTCATTGATCTGTTCCT
TTATTTGTCTAATTAACATATCACACTATTTCTTTACCATAGATACATAATGAAATAAGA
TACTAATATCCCTATATCTTAATTTCCTTTATCAAAATGGCCCTATTGTGGATCATTTCC
ATTCTCTTTTAAAATTACATTTATTTCTTGAGAAAGAGAGAGACACACACCCCTTGTCAA
GGTCTCACTATGCCGAGATCCTTCTTCCAGCTTCCCATTCAGTCCAGATCACAGGACTGT
GGAGACATTCTGGTATGCTCAGATAGACGTGGGCTCTGAACTTGAACCTCTCATATAGCT
CCAGTATTGTGCAGTGGTACCCTTCCCAAGGGCCACTTTGACTGGATCGAGATCCTATTT
TTATATAAATTTTAGAATAGTCCTGTCAGTTTCTGCAAGAACAAAACAAAACAAAAACAA
AAACACAAAAACGACAACAAAAACCCCAAAAAACATCAACAAAAAAACCTGCTGGAATTT
TGGTTGGGACTACGTTAAATGAGGAGTATTGATATCTTAACAATATTGAGTCTTCAGCAC
TGAACAAGGTATATCTAGCTCTCCTTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved