Tupaia_belangeri Locus Mono:218:SNORA68
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:218:SNORA68
Tupaia_belangeri
Mono:218:SNORA68
GeneScaffold_2983
SNORA68
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
AAAATGATTCTTCTACATGACTTATTAAAACACTGGAAGAATGAAATAAGTGAATTCCAT
GTTGCCTTGGGAGCTAAAAAAGAAAGAAAGGAAATTTAATGACAGTAGGAAAATATTTAT
CATCAACACATAATGAAAGAAATAAAATTTAAACTCTGCAGACAAAATCTGATTAAAAAA
GATCATGACAGAAGACCAACGAAGAAGGGAAAAACAGAAATGATAAGTAAATGATACAGG
AATAACAAAGGCAATAACTGAGGCTGGAAGGTGACTCAGTGGTTGAGGCGCTGGACTCCC
TTACGGTGGACTGCAGTTCAAGTCTCAGACCTGGCAGCTTGCTTTCTCACTTTCCCTTTC
TTTCTCTCTCTTGTTCTGGTCAAATAAAAGAAAAATAGTAATTATAGGTAAAATCAAATA
AATGCTTTTTTTTAAAAAAAAGGAGAAGAGATAACTATAGGTCTGAATTAATTTAAATGA
GAAAATGGAAGAAAATTTTCCAAGAGTATGTAAATCACTAAAAATTATGTAGAGGTGAAA
AATCTGAATCAATCACAGTAAAATAGTAGTTACTGATATTCACAAGGTAATTAGACCAGA
TAATTTAATTGGGTTCAGAAAAATCTTGTGGTACTCAAACTCTTCCCGAACAAAGAAAAA
TAGAATATTTCCCAATTCATTCTGTATAGCTAGTGTAACCTCTGCACCTAAATTGTGTGT
GACCTAAAATATGCACCAATCTTATTTATAAAAATGGATGTATCCCATTTCCAAGAATTA
CTGTTTCCTATAGCAGTGGTTTAAACAGAAGTGCAAACAATTAAAGAATCTCATCCTGCT
TAGGGGGCTGTGGCTGTGCCCCTTAAAACGAATGTGGAGGTTCTTGCCCCTTCCCATGGG
GCATAGTCATGCTGAAATTTCTTCTCCATTTCTTCCTTCTTTTGAGATTTTTAAGCAAGC
ACGCACACAAGCCAGCTGTTTCTCAAGCCATTGGGTCTGGGACTTGAACAACACATGTGG
GATCCAGCTGCTTTAACCACATACCATGGGCTGGCTCTATATTTTTTTGAAGCATTAAAT
ATATACCAAGAGACCTTCATTTGAACCTCAAGCTTACTTTGCTTTGCTGGTTACATTTAT
GGGGCTCTATTACTAACTGGTTAAATGATGAGTTATTTTTCCAAGTCTGTCTTTTAAACC
ATCTTGGTCATTCTCAAATAAATGATGTTAAGGTTGATACAGGGAAGTCCTGTAACATCT
GTAATAAACTTGAGCTGTTTTTCTTTTTTTTGGGGGGGAGGGGTATTTAGAGATATTAAC
ATAAATCTATAAGGTGATTTTTTCCCCCCTATTCTAAATGAGGGTTAGGTAAATTTGACT
GATGGCGAGCTTCCTGGTAAAGTGAAGGCAATTCCTTTTTGTACAGGTGAAGCAGACTGA
TCTTGAATTTTAAGGGATGAGTGTGCTCAGGCTTGTAATTGCTATCCCTTGTTCTCTCTT
TCCATCACAACTTACTTGTGCTTATATTTGAAGGGTTTGCATGAGTTGAGTCTTTCTCTT
TATTGTGAACTAATTACCACTTGTGAGGCTGTTAAGTGGAATTTGAAAGTTGCATTTCGA
TGTCCACATAATCAATCTCCCCCCTCCTTTGTCTTCCAAATTGTGAAGAGAAAGCGTAAT
GTGTGCATCTGTGTCCTCAGTCAGCTATTTCTGAGTTTAATGGATGTGATGATTTGTTAT
AAAACTGTGCACATTTAAGAAGTATTCAATGCATAGAAAAGGATGGCAATTGCTAAATTT
GCTATGTCCTCTGTGTAAACTGACAGAAAAGTCATGTGATAAAAGACACTCCTGAATCTT
ATTTTCTTAAAAAAAATTTAATCAAGCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved