Tupaia_belangeri Locus Mono:220:SNORD83
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:220:SNORD83
Tupaia_belangeri
Mono:220:SNORD83
GeneScaffold_5674
SNORD83
1001..1076
2076
AGGAGGAGGAAATGTTAGTTTACTTTATGCCTTTTATTACTGGCAGTAGCAGAGGCGTT
AGAGTGGGTTTGAAAACAAATTTCAGACAGGCATTTTCTAAAGGCAACCCCGGGGCGCGC
GGAGATAGAGAACCGAGGAAGGTCCCTCTTCCGGGCCTTTGCGCCTGCGCCCTGACAGCC
GCGAAGGCGGGAGGCCGGGGAGAGGGAAGCCGAGAACCGGAAGTGAAGGCAGATTCCCTC
CTTCGTTGCTGTTGTTGCCGCCATATGCGCTCTCCTGCTCAGGTAAGGTTCGGCCTTATC
TATTATCCGCCTCCATCTTCGTCTCTGTGCGGCCAACTTGTCATATGGGCTCCTGATACC
TCCTTCGCAGGTGGTGGTCAGTTCGCTGGGCCCAACTGTGTCCTTAACTTCCATTGCTCG
CATCCCCTTTTAGAGCGAGGAGCTCCTTGGGGGAGGCAAGGAAGCTGGTGGGGCCCAATC
CAAGATGGTGGCTCCGGCGCCATTGTGTTCCTTTGCTCCCTGCTTTTCTGTGGGTACCTC
GCTTACCGAAGGCCCTAGCGACGACTAGAGGCGGTGCTCGGCGTCTCGTGGTCCTGGGCA
CTTGCGAAGGGCGGGGCTCTTTTCTTTTCTCTCTTCCCGGGGCCACCTTTGGGGCCGCGA
TGGGACTGGGAGGCAAGAGCCGGCTTTGGGGCCCGGTTCGATTTTTCTCACCTCGACTTG
CGCACCGTTATTTTGGCGTTCTTCCCACGTGTTACGAGTGATATCACTGTTTCTCGGAAA
GGAGTCTCACTTGAGTAACTCGGCGATGGTGTGAGACCCCTTGGTAAAGTTTATGTTAAA
GCAGTACTGCTAGTTTGTATAATATTTTACTCACTGTAGGATGGAGGGGAGAATTTTCTT
GTGGCCGAACCTTTTTTTAAAATTTTTTACGCTACCCCTTAAGCATCGGGTGGGGCGCAC
TGAGGAGCGGGAGACTGGGGAGCTGTGGGAGGTGCACGGCAGCCACATGATGTTTGCACT
GAGAAGTGAGCGCTCTGCGCAGGGATGACCTTAATCTATCACCCTTGACTGATGGCTGCC
TGCACGTGAGATGGCAGGAGGTCTTCCAGTGCTGTCTCCTGTCACGGCCCTTCCACGCCC
CTCAGTCATTAGGTTCTGCTTTTTCTTATCCTTTTTCTTCCCTCTTCCTTACGGGCCCTT
TGACCCCAGTTTTGTTGGGGACTTTCGTGTTAACCCACTTCCCCTGGGACCACTTTCCCG
CGATCTCTGTAGTGCTTGCCCTTTGTTTTTGCTTTGTGTTAATTATCCTTCTCCCACCCA
GTAAAGGTTCCACAGCTCAAGGGAAAGTGGGAAGGGTGTGGGCATAGAGAAACGGTGGTA
AAAACTCTGCTCCAGACTGATAATCTTGTTTTTTTGTTTGTTTGTTTTGTTTTGTAGCTC
TTCTGTCAAAAACTAGTGTCTTTGTTTTCCTCTGCTGTTCCTCAAGCCCCACTCTTCCCC
CTTGTTTTCACCTGTTCTGTGTGAACCCATCTAGACGCCCCTCCCCTCCTCCCCCTGCCG
GCCTAGTTATGGCAGAGAACGATGTGGACAATGAGCTCTTGGATTATGAAGATGATGAGG
TGGAGACAGCAGCTGGGGGAGATGGGGCTGAGGCCCCTGCTAAGAAGGATGTCAAGGGTT
CCTATGTCTCCATCCACAGCTCTGGCTTTCGTGACTTCCTGCTCAAGCCAGAGTTGCTCC
GGGCCATTGTTGACTGTGGTTTTGAGCATCCATCAGAAGGTAAATGTTTTGTTGGGCGTG
GATCCCTCATTAGAGTCTTTAAGGATACGAGGCAGAGGTGTGTCCGTGGTTTCTCAGGTG
GTAAAGGTTTATGTTTAGGAGCGATTGGGAAATACAGTATCAAAAACTATTTCAGGAGAA
GAGGCTTATATAGGCTGAGTGGTAGCTCAAAAGTGCTAGTGATTCAAAAGAATGTAGAGG
TCTGCTGTTTTCGTAGACTGACTCTTCTTGTCTGTTTTTAATTTTGTCATTTTGACTTCC
AGTATTAAGTCTCCAGGAATGGCCTGGTTAGACTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved