Tupaia_belangeri Locus Mono:16:SNORD116
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:16:SNORD116
Tupaia_belangeri
Mono:16:SNORD116
scaffold_54312
SNORD116
1001..1080
1337
GACGGAAGAGACCTTGGAGGACATCAGCTGCCCGTTCTGCGAGCCACTGGAAAGGTCCA
CAAGGTAAGCGTCTCGTTCGGGGTTGACTCGCACCGGGCAGGTTGGGGTACTCCACGCCC
AGGGAGACTTGGATGCCGCAGTGTGTTGCTGCTCCCTAGGAGTCGTTGGCCTTTGTCTTT
CCATCCCAGGCGACCGGAGGAGAGGGTGCCGTTTGGGGCTCAGCCCTCACACCTCAGGTC
CCCGGTCAATGTGTGGCTGGATCGATGATGACTTAAAAAAAAAATAAAGAAACCTTGGAA
ATCTGAACAAAATGAGTGACTACCCTGAGCTGAGGTCCAGCACACGAACCCGGGTAGACG
CACGTCGTACTGAAGGGGATTCTCAGGTCGGCAGTTGTAGACTCGAGGCCCCGGGTGATC
AGAGCCAAACACCGTGACTTGGGTGTGTGGCTGGCAATTGCTGAGAGGTTTAGCAATACC
TGGGAAACTGTTCTGTGGCTGGCCAGCGTTCCACCGGTGTTCCCGCCTCCGTCCCTAGAT
AACGAGGGGCCTGAGAAATGGGCACGTGTGTGGGGTGCCCAGGGGCCCCATTCCGTGCGC
CCTAGAGCCTCAGGCCACGGCATCTAAGTGCAGAGTGCACGCCGTGGAGGCCATCTCTCC
CGCAGAGGAGACCAGATGGCCTCCGGTGCCCCCAAAGCGTGGGATTTCACTGGTAATGAT
GAACGGGTGCCCGAAAGATATCGGCATCGCTGGGATGCTGCCCTCAGCAAACGCGTAGGG
AACCTTCCCGTTACTCTGGAAGTTCTCTCCACGGGCAGAGAACCCGTGAGCATTTGGGGA
TGAGTAGCTCCCATCGAAGCCAAAACATGTTAGCCAATGAGACCGCCTCACACTGTGCCG
TGGCGAACCCAGTGCTCACTTGGATGGAGCAGGTCTCTGTGGAACAGTACCGAGAGCTGA
CCTTGTCTGTCACCGCCGCTTTTTGCTCAGAATCATCCGTTTTTGGGGGGTTTTTGTTTG
TTTGTTAGTTAATCAATTAGTCAATTAATTAATTAATTGATTAAGCAATATATTCATTTA
TTTTTCCGGGGAACGACATTTGAGGCTGCAGCCATGGGTTTGATCGGTGTGGGGAGTAAG
CAGCAGGAGGGCTATGCCATTCAGAGAACCCCGTCCTGTCCAGTAGTGTAAGAGATGAAG
GCGATTCTGAGGGCGTGTGCACGGTGACAGTGAGCATGTAGTGTGATTTTTTCCACCGTG
ACGGACACCTCCGTCTTGCCTCGCGCATTGTCGCCTCACCGCTTTCTTCCTTCTATTTCC
TCTAAAGCCTCACCGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved