Tupaia_belangeri Locus Mono:4:SNORD116
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:4:SNORD116
Tupaia_belangeri
Mono:4:SNORD116
scaffold_39286
SNORD116
1001..1080
1139
TGCAGCCATGGGTTTTGATCGGTGTTGGGGAGTAAGCAGCAGGAGGGCTTTGCCATTCA
GAGGAACCCGTCCTGTTCAGTAGTGTTAGAGATGAAGGCGATTCTGAGGGCGTGTGCACG
GTGACAGTGAGCATGTAGTGTGATTTTTTCCACCGTGACGGACACCTCCGTCTTGCCTCG
CGCATTGTCGCCTCACCGCTTTCTTCCTTCTATTTCCTCTAAAGCCTCACCGTGGCCACG
GTATGGACGCATTGCCTCGCGACTCAGTGGGTGCCGTTGCCCTTATCGCCGGCCGCTTCT
TAGTTGTGAAGGTCGGGTCCCGTCTTGCTCAAGGTGGGTTGGAATGACCCTCGTCTTTTG
CTTGGGATCCCCCAGTGATGATGCAGTGCAGTCCTCGAGGCTTTCCCTCGTGACTTGACC
GGGAGGTGGGGGCACCTTGACGCCTAGCATTTGGCCCTTGGGCTCCGAATCGGGCTGATT
CCAGGCCGACCCTGTTATTTCCTGTGTCCGGGGACCTCAGGCCGACCTTGGCAGTACTGT
CCTCCAGGGTCGAGTGGAGCCTTGAGCGTTCCGCCCATGAAATCGCCCTGCGTGGTGGTA
TTTCCTGGTTCGTCCCCGCACGGGCGGGTTGGGGAACGCGCCGGGCACCTTCCCGGTTTT
GTGGACATACCTGCTCTCGCAGGAAATGGAGGACAGGGAGCGTGCTTCGAGGACAAGAAG
ATTGCTTCTCTCCCGGGGTTGCGCGACGGAAGAGACCTTGGAGGACATCAGCTGCCCGTT
CTGCGAGCCACTGGAAAGGTCCACAAGGTAAGCGTCTCGTTCGGGGTTGACTCGCACCGG
GCAGGTTGGGGTACTCCACGCCCAGGGAGACTTGGATGCCGCAGTGTGTTGCTGCTCCCT
AGGAGTCGTTGGCCTTTGTCTTTCCATCCCAGGCGACCGGAGGAGAGGGTGCCGTTTGGG
GCTCAGCCCTCACACCTCAGGTCCCCGGTCAATGTGTGGCTGGATCGATGATGACTTAAA
AAAAAAATAAAGAAACCTTGGAAATCTGAACAAAATGAGTGACTACCCTGAGCTGAGGTC
CAGCACACGAACCCGGGTAGACGCACGTCGTACTGAAGGGGATTCTCAGGTCGGCAGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved