Tupaia_belangeri Locus Mono:45:SNORA26
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:45:SNORA26
Tupaia_belangeri
Mono:45:SNORA26
scaffold_92568
SNORA26
1001..1115
2028
CCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAAATCTTGGTTTTGTCTCTTTTTATGGAAGTTAAACATTTAAAGACGTACCCAACGTC
CCTGCTCAGGTATCAATAGGAGCGCTCCCACAACCATTGAATGTTTCCCTTATACTGCTC
CTCCTTTCCAAATAAAAACAAACAAACACCAATCCTATTTCTTTCGCAATATTGATTTGC
TCTTCCTCAGTTTTTCCACATCTGCTAAATATGTGTTGCTCAAGATTAGATCCTTTTCTT
GCTTTGAAAGGCCTAGCCCCACAACAGGTGGATGGAACATGTCCGAGCAGGACTGTGGGA
TGGCAAATCGTGTTAATGAGTTACATTCTAGGGTTTGGTTTCTAACACTAACTGTGATGG
GCTTTTTCTGGATCCATTTCTCCAACTATGAAATAAATGAGTTGGACTAGATGACTCTGG
GGCAGCTTCGAGTTTGAAAACTTACACTCTCGCCCTTTCCTGTGCCCTGGTGACGCCATG
CTTTTAGAGGCTAACACGGAAGGGTAAAATAAGTCTCCATAAAATCCAGAGAAGAGATGA
TAAACTCCTCTTTGGATCCTGTCTGGAGTCACAACTGAAGAAAAAAAGAGAAAGAAGAAA
GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA
GAGACAAAGAAAGAAAGAGAAAGAAAGAAAAAGAAAGAAGAGAAAGAAAGAAAGAAAGAA
AGAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGAAAGAAAGAAGAAAG
AGAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGAGAGAAAGAAAGAAAGAGAAAGAAAG
AAAAAGAAAGAAGAGAAAGAAAGAAAGAAAGAAGAAAGAGAAAGAAAGAAAAAGAAAGAA
GAGAAAGAAAGAAAGAAAGAAGAGAAAGAAAGAAAGAAAGAAGAGAAAGAAAGAAAGAAA
GAAAGAAGAAAGACTTACACTCTGATTACTTCCCAGCTCCTCCATGCTCTATTTTTGTTA
CTATATGCTAATATCCACATTAGTTTGGGAAAAAGGAAAAGAAAAGAAGGGAGGGAGAAA
ACCAGTTCTACACTATGGACTCATTCAACTTGTGACTCTCCCTCCCCCACATACTCTCCC
AGATTCTTCTTTCCTTTCTTTCTTTTTTATTTTTTTTTCAAACTGTACACATGTCAAGTC
GATAATGGCCTATCTTTCTTGTCCCATGTACCATATTAGTACATTAGTTTGGGGTTTTGG
TCCTTGTACTTACTACCTTGTGTTTGTCCCCTCTGAACGTCATCTTGGTTGTGATGGTTC
ATCTCCCTCATTTTGTCAGGGTCACTTGGAAGAATTCTATTCCTGGTTTCTGAGGTGTCA
GCAACCTTGCCCAACTGTCACACTTGATGAGCAGACTCCCAGTTCAGTCCTTCAAGTCAC
TGAAGATAACATGAAATCCCATAAAGCTACTCTGTGTGTGGGGCCTCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved