Tupaia_belangeri Locus Mono:100:SNORA57
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:100:SNORA57
Tupaia_belangeri
Mono:100:SNORA57
scaffold_122286
SNORA57
1001..1146
2146
CACAAGAAAAAAGCTGACCAACTGGTGGCATGGCCAACTGCATGGTTTGAGTTCCAGAC
TTGGTTAATTGAAAAAGATTCTGGGTGTGTGTCCTGAAAATCCCAAGAGGAGAATGGAGG
AGAAGGGACTGTGGCATGACCATCCCCCTGGGGGGTGATTTTCTCGCTTTCTGTCTCTAT
GTCTCTCTCTGTCTGTCTGGTGAGTGGACGCGCCCTATAGTGAAAACCTCTCCAAACAAA
ACAAAACAAACAAAACAAACATATTCATAGATCAATAAAACAGGATAGAAAATCTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAATAAGCCCCAAAACATACAACCAACTGATTTTTGACAAAGGGCATAA
GACTACCCAATGGAGAGAAAAAAATCTTTTCAGTAAATGGTTCTAGAAGAATTGGATATC
CACCTGCTGAAAAGATAAAACTGGACTCCTATTTCTCACCATTAACAAAAATCAACAGAA
AAAAATGGATCAAAGATCTAAACGTAACACTTCAAAGTATAAAACTACTTCTGGAAAACA
TAACAGTTGAAGACATTGAGTAGGCAAAAATTTCATAATAAGACCCCTAAAACATAGGCA
TCATTTAAAAAAATAGACAAGTGAAGTTACGTCAAGCTAAAAAGCTGCACAGCAAAGGAA
ACAATAGAATGAAAAGACAGCTCACAGAATGGGAGAAAATATTTGCAAACTATGCTTCAG
ATAAAGGGTAGATAATCAGAACATTTAGAAGACTCAAGCAGCTCACCTGCAGAAAAACTA
ATAATCCAGTTTAAAAATGGGCAAATGAACTGAACAGACAACTCTTAAAGGAAGACATAA
GAATGTAAAAAAAAAAAAAAAACACATAAAAATATGTTCATCCTTTCTTTACTTGGCAGG
AAGTGAGTGTGTGGTCCCACTCCCTGTTATGTACAGAGGCAGAAGGAAAGGGGCTTAAGC
CTTCTCAGTGTCATGTCTTTGGTGCTGGTGGCTTTCTTTATTTCTTTCTTTCTTTTTTTT
TTTTTTCTTTTTTGGAGAAGTTTTTGCTATAGGGTGCATGCGCTTGCCAGAAAGACAGAG
AGACAGAGAGATAGAAAGCCAGAAATCACCCCCAGGGAGGATGGCCATGCCGCAATCCCT
TCTCCTCCATTCTCCTCTCGGGATCTTGGGCACGCTTGCACACGCACCCAGTGTAAGTTT
AAGCCACCAGGTCTGGGACTTGAACCGTGGTTGGCTACATGGGAGTTCAGCGACATAGTC
ATTACACTAATTGCTGGTCCCAGTGCTGGTGGCTTTCCATCTCCCTGTTCTATCCTCAAG
TGCTGGGACACAGGGTTAAAAAAGTGTTAATGTCTCTTATCATAACGGAAATGCAAATCA
AAACCACAGTGAGGTATCACTTAATCTCATCAGAATGGCTATAATTACAAATAAAATAAA
AATAAAAAATAAACCTTAGACTGACAAGTGCTGGTAAGACTGTGGTGCAAAGAGAATGTA
AATTAGTTCAGTCACTGTGGAAAACAATTTGAGTTTCCTCAAAAATTCACAAATAGAACT
ACCCAGTAGTGACCCAGTAACCCCGTTCCTTGGTACTTATTTAAAGGATAAGAAAGCCAT
TGGAATGACACTTGCACATTCATGTTTATTGCAGCATTATTCACAATTGCTGAGACAGAA
AATCAACATAAGTGTCCCCAAACTGATGACTGAATTTTTAAAAATGTGGCATATATACAC
CATGGAATACTACTGAGATATAGAGAACAGCAAGACTCTGTCATTCAATATAAAATGGAT
GAATCTAGATGATCTAATGCTAGTGAAATAAGCCAGGCTATGAAAACAAACACAGTATGT
CTTTGCTCAATATATACCATATATCTGCATTCAATGGGAGAAATTAAAGATTCGAGGACA
CCTAATTAGGGGGGATGAGTAGATGCCAGAGACTGTATGGGGAGCCGGGGAGTGGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved