Tupaia_belangeri Locus Mono:37:SNORD85
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:37:SNORD85
Tupaia_belangeri
Mono:37:SNORD85
scaffold_126776
SNORD85
1001..1069
2069
TGTGGCCTGGTGGTTAAGGCAGCTGGATCGCACGTGACCAGATCTGTGGTTCAAGTCCC
ATACCTGGCCAGTTGAAAAACATGCCAGGCATTTGTGGTGGGTGCCCAGAGTCCCAGAGG
GGGAGGAATGGAGGAGAAGGGATTGCAGTGTGACCTAGCCTGTGGTAGCAGTGCCATCTT
GCTTTCTCTGTCTCTTTTTTCTCTGGTCAGCATGTGTACCCTCTGGCAACTTAAGGAACG
AACAAAAACAGATTATCGCTCTGTGTGTGTGAGAGACGTTCTAATGTACAGGTCTAGGTG
GATCGTGCGCATTCACCCTGTCTGCGCTGCCCTTCCCTTCCCCTGTCGTCATGGCAGTGC
CGTCATGTAGCCTCTGTCCACTGCCTGTCCTCACTGTAATGGCGCCCTCATCAGGCGGGG
GCATCTGGTCTGGCTTGTTGCCCTTTCGCCAGTACTTGCCTCATGGCAGGCATTAACGCT
TTCCTTTTTCTTTTTTCCTTTTTCCAGACATTAATCTTTGATTAGTGACAAATTATCACT
TTTATATGCTTTGACTGCTCATAAGTCTATGTTTAGATGGGAGGAGATCTTACTATACAG
CAGATTATTCATTGGAGTTCTATCTTAACATAATGACACATAAAATGATCATAGCGAAAA
TGAGTCGACCCCACTTGAGCTCATGGTGGGTATCAGGTACTTTCAATGAAAAGAAAGTAG
TTGACTTACTTTTGTCTCCCATTCCCAGGTTCTCCGTGGAGGAGCCAGTCAGCGCCCTTT
GACCCCAAATCAGAACCAGCAGGGACAGCAAACAGATCCACTAGTGGCAGCTGCAGCCGT
GAATTCTGCCCTTGCGTTTGGACAAGGTCTGGCTGCAGGCATGCCAGGTGAAGCCGCGTT
CTTGTTTCTAGATGCTTAGGGGGAAGTCTGCTTGCTTGGGGCAGTGCAGAGGCCAGTGGG
CAGTGCTTTGAGATCGCTCAGCGTGTTGCGATGTGGGGACTGGCAAGGATGACATGCACT
TGCCCTCACTGAGACCACGGTCCATTGCTGAGAGCGTTGTTCTGAGCCCGTCTTCCAGCT
TGTGTGTTAGAGGTAGGTGGACGCCCGCTTAGCTGGGAGTACATGGTTTTCCTTTTCTTC
TTCAGGACCAGGAAATGGCCAGGCTACTCTCACTTTACTCCAGGGCTTTCCTCTGTGCGC
CATTGTCTTTTAATAGCATGAGCAAGATGAAATTCCCTGATAGTTCTAGGATTTCTCCCA
AACCAATAAGTAGCAGGGGTGCTTTTCAGCTGCCAGCCTCTGAGGTAGTAGATAAAGGTG
AATGTTGGTCTGGGGAGTCACGATCATTTCCACATAGAAAAGTGTGCCATGATCAATACC
GATGCTGTATCTTGGGTAGAGGTTGTTCTTGGCTCACTGTCTTCAGGCCCTGTGCTTTGC
ATGGATCTGACAGACGGTCAGACGTGGTCTTCGTTTGGGTGCTTCCGGTGTGAGACCTCA
GCTGCGCTCACCGGCCTTTACTGACCGTAACATAGTCAGGTCAGTGGTGCCGCATCGCTG
TGGTCCATTGTGACCTCAGCGAATGACTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved