Tupaia_belangeri Locus Mono:5:SNORA57
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:5:SNORA57
Tupaia_belangeri
Mono:5:SNORA57
scaffold_125078
SNORA57
1001..1142
2142
TCATTGTTTGATCACTAAGCTATGTAGATGCAGGCATAACCCCTAGCAAGTCAGGTTTA
AAAATAAAAACAAGGAGCCTGGCTCCCTGGTGCAGTAGCAATGTGCTGCTCAAGAGAAGC
TGGATCCCACATACCAACCTTGGTTCAAATCCCTGGCCCAGTAACCTGAACACACCTCTT
TGCTCAAGCTGACCCACATGGGAAGGTTTTGAGTTTATATTTGGCTGTCTCTCTGAGTAC
ACTGGGCACACATGTGCCCATGATCCAGGGCTGACTGAGGCTGGAGTTGGATCACAGTGT
CAAGAATTACGGTCTCTCTTTTTCTCTGTCTCTTGTCTTTCTTGCTTATGGAAGAAATAA
TTAAATTTTTAAAAACCTTTAGAAAAATGTAAAATAAATAACAAGGATTTGAAAAGAAAA
GAAGCTAAGTAGAGACATCAAGTTGCCACATGCCATGGGAAGACAGATTTCATAGATATA
GTCCAGGCAAATTACTAAACAAACAAAAAAACACAACCCTCATGGAAAATTATAATCAGG
TTGCTATAATATATTCTGTAAGACAATCAGTTTTTGACAAAAAAATTATGAGACAAACAG
GGAGGGTGATTTCCATTCAGAGGAAATAGTTCATGAAAACTATCTCTGAGTAAACCCAGA
TGTTTGATTTAGCAAAGACTTCAGCACAGCTGTTAAAAATATGTTCAAAGAATAAAATAA
ACTATATTAAATATTAAAGAAATAGTTAATGTTTAAATATTTAAAGAAAAGGACCAGTAA
TTGTTAAGTGATAACTGCATCTTTTCCAGATTCCACGTGGCCATCCAGGGCTTGAGCTCA
GCCCCAGTGACTTGAGAAACATGCCAGTTGTGTGAGCTTGCCCAGGATCCTAACAAATGG
AGAACTGGAGGAAAGGGATTATGGCATGGAGTAGTCTCTCTCTGGCCCTCTGTCATTAAA
ATTTTTTAAATAAAAATATGATGGCAATGCCTCAATAAATCTCAACAAAATAGAAACTTT
TTACAAAAGGAACCAAAAGATGTATGTAGACAGAAGGAAAGGGGCTCTTGCTCCCTCAGC
ATCATGTCTTCAGTGCTGGCAGCTTCCTATCTGCGGGTTCTACCCTTCAGTGCCTGGACA
AAGGCAAGCATATGTGCCCTATAGCAATAACCTCTCAAAAAAAAAAAAAAAAGTCAGCTT
AACATAAGTTGCAAAATATGAATATCCATTTGAAGAGCACAGAAGTATATGCTTGAGAAA
ATGTTTGTAGGGACCAGCAGTGTCACTGGACTCCCATGTAGTCGACCGCAGTTTGAGTCC
TGGACCCAGTGGCTTAAAACTCAAGCCGGGTGTGTGTGTGTGTGCGTGCCCAAGATCTCG
AGAGGAGAATGGAGGAGAAGGGATTGTGGCGTGGCCATCCCCCCTGGGGGGTGATTTCTT
GCTTTCTGTCTTTCTGTCTCTGTCTGGCGAGCGCACGTGTCCTGTAGCAAAAACCTCTTA
AAAAAAAGAAAAGAAAAAGAAAATGTTTGTAGACACACAGGTACCACACAAGGATATTTT
TTATCCTTCAGACATTTTTTCCCCAAAGAATTAATTTTACTTATTCATTCATCTTTTTAA
AAGAATTATTTCATGTAATTTTATTTATTTATTTTATTTATATTTGACTAGAGAGGGATG
GAGTGAGAGATAGAGAGAGAGAAAGTGAGAAAGCAAGCCGCCAGGTCCAGGATTTGAACC
ATGGTTGGTCATGTGGGAATCCAGCAGTGCCCTCAGCTACCAGGCCACCTGCCAGCCCCA
TCATTCATTTATTTTTAAAATTTTTTGGAGAGGTTTTTGCTATAGGGCACGTGCACTCTC
CAGAAAGAGAGGGACAGCCAGAAATCACCCCCTGGGGGGATGGCTACACCGCAATCCCTT
CTCTTCCATTCACCTCTCGGGATCTTGGGCACGCATGCACACGTGCCCGGTGTGAGTTTA
AGCCATCGGGTCCAGGACTTGAACCATGGTCAACTATATGGGAGTCTAGCAACATAGCTA
CTTTTGACCAGACACACAGAGAGAGAGAGAGAGAGAGAGAGAGATAAAGCCACCAGGTTC
AGGACTTGAACTGTAGTCAACCATGTGGGAATGTCCAGTGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved