Tupaia_belangeri Locus Mono:222:SNORD113
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:222:SNORD113
Tupaia_belangeri
Mono:222:SNORD113
GeneScaffold_2266
SNORD113
1001..1077
2077
CAAACTGTTGCTTTTGCAATACCAAGTCTCTTGAGATTCTTCAGCAACTGTAAAGGCTC
AGGTCTTGATAAGAAAGAGACCATGGCCGCACCTGAGGCTACATGGTAAGGACAGGCCTC
GACAAGACCATAAAACAGGTGGTACGGTAGTTTCCAAATCCACGAAGTTCCCCGCAGAAA
CTCTCTTGCGCTGGTGCCATAGTATTCCAAGAAGGAGCACAAGTTAGCACGGTTACCTGA
AATCGGAAAGAAGGTCTCCCTCCTTCCTCTTCACCCTGAACCTGCTGTGTCAGCGGTGGG
GTGGGGGGACACAATCGGCATCAGACCTCTCTCTATGGAAACCCCGAGCAGAACGTGTCC
TGGGATCATTAGTTTTGCCCAAAGGTGGCAACTGTTTTCAGAAAGCCAAATGGACACTCT
TCTTCTTCAGAAATGAAATGACAAGGCTGGAACTACCTGGAGGCAAGTGGCAGTAAAGAG
GCTGTCTCTGAGTCTGTCTGGCATCTATGCCACTCTGCAGGCCACACGGGACACTGGTGC
AGGAAAACAAAAACACGGGGGACTTGGCTGTGACGAAGGCACACAGGCATCGTCTACTCG
GCACATGCAGGGCCAGGTGTGCCCGAGAAGGAAGCAGAGATGGGCAGATGGGATTTCACA
CCCTGCTTAAACCCAGAGGACCCTGTAGCTCTGCGAACACTGGGTTTCCTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATGAAACATTGTGCCAAATTATATATAT
ATAAAATAGTTCATGAAAGTGGTTCACTGATGTGAGAATAATTTTATATACAGGTTAGGT
ATATAAAGACTTTTTAAAGTTTTTGTGAATTGTTATTTTTGTGATTTAATGAATTAATCA
ATAGACCTGTGCAGATGACAATAGAGAAAGAAGGTCAATTCTGGATTGATGATGACTACT
GGTAGTGTATGAGTCATGTCATGTACGATGAATATGTGTCTGGAACTCTGAGGTCCAATG
GGAAAGAAATGCAATCCATTTCCTCTTGTTGAAGTGACCTTATAGACAAATGTCAGGAAT
AACTGAGAATCTCAGCTCTTGGTGTCCATGCATTTCTACTCTTTTATTTTAGTTGGATCA
AATGAAAGAATCAATAAATATATAAATGCAGAAACACAAATGAGATAAAACATTGCTCAA
TTATAGAAATATTTGATGGGTCAAGAAAAATGTCAAAATATTATGGCAACCCTGGGTCTA
TTTTTATTTTTTTAGAGGGATTTTTGCTATAGGGCTCGTGTGCTTGCCAGACAGACAGAC
AGAGAGATGGAAAGCAAGAAATCACCTTCTCCCCTAGGAGGATGGCCAGACTGCAGTCTT
TTTCCTCCATTCTCTTCTTGGGGTTTTGGGCACCCACACACATGTACCTGGTGTGGATTT
TAAGCTCCTGGGTCTGGGACTGGAACTGCAGTCAACTATATGGGAGTCCTGTGATGTAAC
CATTACTCCATCTGCTGGTCCCACCCCTGGATCTATTTTAAGTAAATGTTACATGAATGT
TACCCCTGGGGCAAAGGATGACATAGACAGCATAGGTTATAGTGTCCATATTCTGCATTG
GAAATTAGTCTGAAGCTCATTTTGTAAGACAAAAAATATGTTTGACAAATTAATTACCTA
AATGACTGACTAAATGAAAGGTGAAAAGCAAGGACCAAAGGACAGAATATGTCATTTAAA
AAAACATTTTTTGTGATTTGTATTCCTCAGAATGGATTCAGTTAAACTGATTTAAAGATC
ATTCCATAATAAGAAGCTCTTCGAAGCATCTCTTTGTTAGGATCCTAGAGAGCAATATGA
GTAATAGCCAAAGTTCTGGTTTTGTTTTGGGTGGTTTGTTTAAAGGTATTCACTGTGTTA
TTAAAAAGTATGAAATAGGGAACCAGCAGTTAGCGTAATGGCTATGTCGCTGGACTCCCA
CATAGTCGACCGCGGTTCGTGTCCCGGACCCGGTGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved