Tupaia_belangeri Locus Mono:73:SNORA61
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:73:SNORA61
Tupaia_belangeri
Mono:73:SNORA61
scaffold_4651
SNORA61
1001..1138
2138
TTGAATGAAACCATTAGCCATGTTTCAGGCATCCCCTGGGTCTCTTGGAATGTCTCCCC
TGTGGATATAGGGGGATACTGAACTTGGGGAAATAATGCAAAAAAAGTAATTATTAAATG
ATTTCCATTAACAATGAGAGAGAAGTAGGTAGAACTAAAAGAAAGAGTGTGATCCCAAAT
ATACTACAATAATAGCCCTCAGAAGTGTTTGCTGTTGTGTTCATAGCCTTGTGTCTTAAA
AGCAGCCCAGAATATGTTTGGGTGTTGCTACTCTCCCTTACACCCCCTTTTGTTTCCTAT
CTGTATCACCCCTTGAGTTCCAGTGCTTTTAAGTTTTCTTGTTTTCTTTAGATATCTTAA
TTCACATTAAAACTTTGTGGAGTTAATTTCTTGACCAAATTTCATAAGTCATTTCTATCT
TTAAGAAAATAGTCTACCTTGTGAAATGTTTAAGAACATCTCACATGGTAAAGTTTAGGC
CTCAGTAGGTAAAATATTTGGAGAAGGGTTGCCGTATTTGTATATTTTTTTCCCACTAGA
TGACATGCAAGTCTTCCATGCTTATATAAGAACATATATGCAGCGCAAGTTATAAATCTT
ATACCCAAAGAATTTCAATCTCATACACAGATTATTTCTTCTGGAAGACATTTCCAAACT
CTCCTCTTAGAAATTGCTTGAGAGGGGACCAGCAGTTAGCGTAATGGCTTTGTTGTTGGA
CTCCCATGTAGTTGACCATGGTTCGAGTCCCAGACCCAATGGCTTAAACTCATGCTGGGC
ATGTGTGCGTGCGTGCTCAAGATCCCAAGAGGAGAATGGAGAGAAGGGATTGCGGCATGG
CCATCCCCCCCACATTGCTGACTGTGGTTTGATTCCCAGACCTGGCAGCTTGCTTTCTCA
CATTCCCCCCTCTCTCTCTTTCTCTCTCTGGTCAAATTTAAATAAATAAATAAAGTTAAA
TTTTTAAAAAGTTGTTTGAAATGGTCAATAGAAAAATTAGGACCCTCTGACTTCCTTCCC
CTTTGGAACTGAACACTGGTCTTGGTGGTAGTTAAAACGAGGTAGTAAAAAGTAATACTG
AAGCTGGCCATATGGTGGTGTAGCCTGGTATACAACATGTGGGCTGGTTTTGAACAGGCT
GAATTCTTTGACTTTGTTTCTTTCTCCTCCTTCAAATGGGGGTGGCAGGGACAACTGTTG
GCATGGTGGTTAAAATGATAGGATCCTGCAGGTTGACTGCTCTCCAGCCAGAGACCTGTC
AACCTGGTAAAAATAGCATCTGGAGAGACCTAGTGTACTTTTCTTGCCTCTTGATTGAGA
GTGTCTTTTTATTTTCTTTTTGTGGACCTGTGTTCCTACATGTGAGTTGCATCTACAGAG
CTGGGAGAGAAACACACAGGAAGAGATAGCAAAAGGAAAGCAGCGTTTTCAATGGGATCA
GCTAATGTTGCATCTGTAAGTGGCCAATGAAAGACTCTGGGAATGTTCTTTTAAAAAAGA
AAACTTAAATTAGGAAAAATATACCCTTATGAGTTACCAAATTAGATGAAAATGCAGTAC
ATCTTATAAAATAGGAATGCTAATCAGCTATAGGACAGATGGAAATAAACTAAAAAAGAA
GTCACCTATGGATGAAATTTTAACTGCATTTTCATAAAAAAAAAGTATCATGCTGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAATCTAGAACATCGATCAGCAT
CAGTGAGCTGCAGAGTAGTGCTGGTGTGTACAAATGCTGGAATGATATCTATTTACTTCT
CTATAGGATAGCAGCAAAGTATGGCCCAAACAAGTGACTTTTCAACATTAAATCATTTTA
TTTATAATTATACCATAAAAACAAATGTAAGCCAGGAATGTACTAAACAAACCTGAACAT
ACAGTCGCTTCTAGCTCTAAACAAAGTAGTTCTTATTTGGAAATAAAAATGAGAATTTCC
TTCATCCTGGAAAGTATTTTGAGTTCTGAAGACAAATGTTCTAATTTGAATGAGCAAGAT
CATGGAAAACATGCTCATGATTTAGAAAGACCAGAGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved