Tupaia_belangeri Locus Mono:174:SNORD113
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:174:SNORD113
Tupaia_belangeri
Mono:174:SNORD113
GeneScaffold_349
SNORD113
1001..1062
2062
GGAAAGTTCTCTCTCTCTTTCTCTCTCGTTCTCTCTCTCTCTCTCTTTTCTCTCTCTCT
CTCTCATGAATGCACATGCCTTCTGGTAATGGGAAAAAAGAAAAACTGAAAAACACAAAT
GCTGTAGAATTAAACTGATGATGCAAATAAGCCTTCAAAATTGGTAATCTAGGCAAAGAG
ATGGGTTTCTCATTCATCAATACAGAGTTCTGAATAACCAGCAACTAACAAAACTACCCA
CAAATCTGAAATAACTCTATATATTTCACAAAACCGAAAATACTAGAGAATAAGTTTGCT
TAAAGAAAGACACAAGTATTTGATTTACAAATGTTTTTGCTTACCCTAATACAAAAATTA
GTGGAAACATACCTATTTTAAAGATAAGAAAATTGAGGCTTGGAAAGGTTAACAAACTTG
CCCAGATCTACAGATTCCCTTAAGCAACTTCACTTGGTGATATATATATATACTGGCAAT
TTTCCACTTAGACGTGTTTCCCTTTAGGGGATACATGGTGACTTTCCAAGAGGGTAAACC
TGGAATTGTTTTAAAGGGATTGCTATATGATCTCCTTTCTAAAATTGAGCTGTGAGAATG
GCCTACACATTCAAGCTTTCCAGTTTCTCATCTCAAGGTACAAAATAAAAACATACTCAA
CAATATGGCTGAATCTTAGCAATTAGTATTAGTAGGTCATTTCCAAAAAACTGTGAACAG
CATGACACCCATCGATAAAATTAAAAACAACTAAAATTTTACCATGAAACTTTGTACGAG
TACAGATAAATGGCCAACAAAAAGTATATCCAAAGGCGGGGGGGGGGGGCAATGATGGTT
ACCTTAAGTGGAGGAAGGCAAGGGATAGGTTGGTAGGGGGAGGAGTTATGGTATGATTAA
AGTAGGTTATTTTCAAGGTTCTAGTTTTTGTTTGGTAGGTTCATGGCTGCTTATTATTTA
AAATAACTAATTAAATAACTTAAACAAAAGAGAGCCATGCATGGACCAATGATGAGTGAC
ACAAAGATTATGATTAAACCAAGTCTATGCACCTGAGGTCCAAAAACAAAACAAAGGCAT
ACCTCTCAGCCATCTTACTATGGTGCATTGCCTCAGCGTGTAAAAACCGCCTGGAGTAAC
AAACAAAGGGACAATTTGAAATATTGATATTGGGAAGCGTCAAGGCATCATAAACCCACC
AAAGACTTTTCTCTGTGTATGTGGGTGAATGCATGCACGCATGTGTGTGAGACAGAGACG
ATGTGGGCCTCGGCCTCTGCTGGCATGTTGTGGTACTACAGAGCAGCATCAAGGAAGTGC
TTTCACCTCTTCCACCCTTACGGTCAGGGAAAGCACTGCTCCTGTGCAAAAGCCCCATAA
GAGCAAAGCAAAGAAATCCACTATGTCTTCTGTACACTCCCACGACATAAAGGTAAAAGA
ATTTTTTATGAGTGATATCAACACTCATCTGCAGAAAAGATAAACACTACCCAACAAGTA
CCTGAAACAGTGCAAGTTAGTGAGGCTGCTTGTTAGTTTACCAGCAATGTTTTCCCAACA
ATTCAACTTTTATGTATACTCTTAAAGGTCTAAATGACAGCTCAGACACTTGCTCAGTCT
TATTGGGCAAATAACTTGACCTCTGTGCCTCAGTTTCCTTATCTTTAAAAATGGGGTTAA
TGTACTATTCACCTCATAGGGTTGAGGTAATATATATTCACAAACACCAGTGCTTAGTGT
TTATTTCATTTTTCTTTTTTAGAGAGGTATTTTTTGCTATAGGGCATGTGTGGTCACCAG
AGAGACAGAGAGAAAGTGAGAAATCATCCCAGAGTGTGGATGGCCACATCGCAATCCCTT
CTCCATTCTCCTCCTGGGATTAGTGTTTAGTGTTTCTCACACAGTGGCATAATATTTTTG
TTTGATATCACTCATCATCATTCAGTAAGCTAGTTTGAAACTATTTTCCTGATATATCAT
GAAATATTTATTTCAATGACAAATGATGTTTCACCTTGTAAATAAATTATTTAATTCTTT
TTACTTTCTATTAATTAAAAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved