Tupaia_belangeri Locus Poly:11:SNORD81
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:11:SNORD81
Tupaia_belangeri
Poly:11:SNORD81
GeneScaffold_5544
SNORD74, SNORD75, SNORD24, SNORD77, SNORD44, SNORD78, SNORD79, SNORD47, SNORD81
1001..1077, 1436..1497, 1663..1743, 2183..2249, 2531..2591, 2839..2903, 3311..3385, 3948..4026, 4171..4246
5246
GGCTTCATCTGCGTTAGGGAACGGGGGTGAGGGGAGCCGGCGAGGGGCGATGTCACCGA
GGACCTCAGGACGCGAGGGGACGAGGTGCCTAGGTAAGAGCTAGAGGCCAGGAAGGGGCG
GCGCCGACACGGCCCAGGCGGGAGCGGCCGGGGTGGGTGTGTGCCTGGGTGTGCCTGGGT
GTGCCGGCGGCGGGGGGCCGCCCACCCCGGGGTCCTGAGGGAGGGGCCCCGCGAGGGGGC
GGGTCCGGCGATTTGGCCGGCCGGGGTCCAAGGGGGTGGAAGGTCGTCGGAGCCTCGAGG
GGAAGAGGGAAGTGCTAAGCGCTCCGGGAACGCGCCACGGCGGAGACGCGCAAACTGGGC
CACGGAGCGGGGCAGCGGGACCCGGTGCGGGGCCCGAGCCCAGGCACGGAGCAGCACCTA
CCTCCGGGGGTGGAAATGGGCCGGAATGGGCCGGAACACCGTTCCGGAAGTGAAACCCCC
CACCCCCTCCCCCGGAGCGGGCGACGTGCCGGAAAGAAATCACTCACCCTCACACGCCCC
CTCCCCCCCAGCTGGCCCCCTCCTCTCGCTGCTCTTCCTCCTGGGCCTGGAGGAGGGCGA
GGCCGGGCGGGGCAGGGAGGCCGGCCTAGAGGACGGAACGGAGGCGGGGCTCGAGAAGGG
GCGGGGCTGACGCTCACGGGAAGCGTGCGTCATGACGTTACGAAGAGACTCCTTATATAC
GAGAGCCCGGCGCCATAGAGGTCTTTCGAAGCGGAGAGCTGGTGAGCTTTAGGTTTGTAT
CGATTGTTGACCTGAGGCGGTTTTTTTTTTTTTTTTTTCTAATCCCTCGTTCATACATAG
ATAGTGAAGGTCGTTCTAAAGTAGGTGGCGTTTCGGGGCCGTTCGTGCGCCGTTGCAGGG
CCCACTAGAGGAGGATGGTGGAGGATTGTGTCGTGGGTGCAGGCGCAACATTACCTGCTG
CCGGAGTTGTTGAGCCAGACTGCGGAGACGTCTTGGCGCGCTTCCCCTGCCTCTGATGAA
GCCTGTGTTGGTAGGGACATCTGAGAAAACTGATGAATGCCAACGGCTCTGATGGCAGTG
CGTGCCAAGTTAGCTAAGTGTGCTGTGCCTTAGGCTTCGGCTCATTCTCTTAGAGGCGCT
AATTAGGAAAAGGTCGGTAGTTGGCGGCCAGAGTGCATCTGCAGTGCACCATAAAACATT
TGTGGTGCATCCCCTTGGGTGCAGTGCTCTGTTAAAACATTGAGCGCATCGTTTACTTTC
GTGAAATTAAATTTTGGTTGGTATAAGCTATGTAGATTAAAGTGAATTAAAAATCTGTAT
AATCTTTTCCCTAGTAATGATGCCAGAAGTGGATGTTTTGTGCCTTATGAGGGCGTCATG
TGGACAGGTAAGAACTGCGGGAAGGTACAGAGGGAAGGAAAAGTCGAGTCTGTTAAAGCC
TGTGATGGTTAAAGAGTAGTGGACAGAAGGGATTTCTGAAAAATACTGGGCTGAGGCTTT
ACATAGTATTAAAGGAATGGATTCCTGATTTACTCTAAGGCTCTTTCACAGTTTTTTTTG
CATCTTGTTTTCCAGTTACATGCCAAAGGGGGATGAGAGGGCTGCTGAGGTAAGTTACTG
ACATTACTTTGCAGAGTGGAGCTAATATTGAAAGGCATGAGTGTGCCACGATGATGACAT
TTATTTGCTACTCTTGACTGGGAGGATGATGAGAATCTTCACCACCATTTTACTAACTGA
GGCACGTTAAGTGGCGATTTGGGGAACCGAAAGAGTGTACCTTAATTCACATGAAGTTGT
TTCTTTCCAGGTCCTTAAGAGGAAACCTCTAACAATGTCTACACAGGTGAGAAAATCAAC
AGAGGGGGTCAGAACATGGCATAAAGGTGAGGCTTATGCCACATGACTGACCAAGGTTCA
AGTCTAGACTTGGAGGCTTGATACAACTTGCATGGGGAAGGACTCTGGAAAATGGAGAAG
GGATAGGGGAATGGCCATATACCCTGGGGGAATTGCAAATTTTTCTTACTGCTCTGGCCA
GCACAGAAGTCTAATAAAAACCTTTGGGGAAGAACATCACTAAATGATGGTGACTAAAGT
GCATGATGCAGTAGGGTCTATTACCTCTGGTTCTTAAATTGTGTTCAATTATGGATAAAA
AAATGAAGTCTTGGGGAAAACAGATACTATGATGGTTGCATAGTTCAGCAGATTGTATCA
TGAAGATGAGAACATTTGTCTGATGTATCTGGGGTGGTTCAAGTATGCTGAGCATAAGCA
GTGTACTAACTACACTAAAGCCCAGTTTCATTTTTTTTTTATTTAAAATCTATTCTAGGC
ATTGAACAAACCTGCAATTTTAAAATGGTAAGTAGAATTGTAATTGAAGAAAACAGGTAA
CTGGGCAAACTAAAGCACAAATTACTTATTAGAGTTACGTTTTCTGTAGTTAAGACCACC
CATCCCACCCATCATAAGCGAATGCATTGGGTAAATGCCAGATCTTTAGTAGGGTAAAAA
TGTAAATGCAGCCTGGATGATGATAAGCAAATACTGACTGAATATGAAGGTCTTAATTAG
CTCTAACTGATTCAGGCATGTGTTAACATGGGGAGAGAAACAATTTATCTTCGGCTGTTC
TAAACATACTTCACTTCACAGGTGGAGTGGCTTGTTTGGACCAACCTAACATAGTAAGTA
TTAACAAACAATAGGTTGAAGACTTGAAGAAAATGGTGATAAAATGGTTTCTGCTGAGCT
ACTAGCAACTCATAACTTGATATTTCTTCTTGGCTAAATGCAAACTGCATTTTCTTTGAG
CATGCTCTGAACGGGGTTTTTGTAATGATGTTGATCAAATGTCTGACCTGAAGTAAGCAT
GTAGACAAACATAGCACTGAAAAGCCCTGTGATAACTCAGAGAAGAACTTAATGATGTCA
TATTTAGTATTTTAATGAAACTTCATGTTTCTGTTTTAGCTATTGGTTAACACGTTTTTA
AATCGTTGGATGGCTTGCTTTTGGTAAGGACCTAACAGTGGCTTGTGACTAATATTTTGT
AACATGGCCTTACTAATAAGTTCTTGAGGGAGTGACTTTGTTAATGGGTAAAAGTTCTGA
GAAGTTAACTAAAATTAGAGGACTTAAAACATAAAAATATATGTGTAATTGAATGCCATT
TGCTTTAAAAAGTAAATGGTTATTCAATTAGAAAACAAAAGGAATTTTTTTTCCAGGTGC
AGACTTTGGAAGCCATTGAAATTGAAGGTATATATTTTGCTAATAATGTATATTTTTTGA
ATCTGATGCTGTTAGTGATGATTTGTAAAAGTTAAAACAGATGGGAATCTCTCTGAAAGA
GAATGAAGATTAATTTTAAACTGAAACAGTAGTTGGACAATATTAGAAACCTACCTACTA
CTATTTGTTACTAAATCTTAATGATATTTCTGCAGGTATGAGGAGTCTGAAAACTGTAAT
GCATGGGGACAGCAAGAAATTACCAGACAAGGTAGAGCAACATTAAGTTGTGTGACTGAT
ATAAAGCCGATACAGTGATGATAACATAGTTCAGCTGACAACACTGATGAACCAGCATTA
AGTCTTTCGCTCCTATCTGATGTATCTGGCTGTGATGGCATATTTTTACCCTTCAAAAGG
GGAATTTAATCATTGTCAAATAGAAAATGTTTACAGGATTGATTAGACTTCTGTATTAAC
ACCTTACTGTCCTATCCTCTCATTTCAGGAATAAGAATGTACATGTGGAAGAGTGCAGGT
TAGTTCAAATTAAATAACGTTTTCATGAGAAAGATTTATGTCATCCATGTAAGACAAGCA
GTTAATTATAAATGGATTTTTTTTCTCCTTCAAAAAGGTAGACTTCCTGTTCACCCTATA
AACTTGAAGGTGAGTCAGTTTTTGGTACATAAAAATCACATTGAATGTAACCAATGATGT
TAATGATTCTGCCAAATGAAATAGAATGATATCACTTATAAAACCGTTCCATTTTGATAC
TGAGGTTAACTCTTCTAAATAAGTATTGCACAAATTTTTTTTTACTATGACTAATTGTTT
TCTTTAATTACAGGGCCTCTATGATGGCAGCAGCCTTGTGGCTTAGCTTTTAGAAGGTAA
GAATTGAAAAATTCTACCACGGACCTTACTCCAGAATATATGATGATCTCACCAAACTTG
AACTCTCTCACTGATTACTTGATGACAATAAAAGATCTGATATTCTGTCTCTCCCAATAG
CATTTGAACTGAAATCTGGTACTGTGGCTAATGCTGTTCCCTTTTTTGCAGGTACAGGAT
GGATGTTCATGGGATAGAAGATGAAGCATTAAAATGTAATAAATTGCTACAAACCTGGAA
GAGTGTTTGTTTAAAATTTAATGGGAGGAGGGAAAAGTTACCCAAGTAAGGAAGGAATAC
CACCTGAGTGCTTTGTCACTTGTGTGAATGCGTACAATGTGTCCAAGTCAGACAACATGG
CATGTACTTCATCAGCCACATGGCCAATTGAAATTTTGAAGAAAACCATGGAGACAATAG
ATTAACATAGAGAAAAGTAAAGGTGATTGGACTATCACATAAAGGAATTTTCAGCCTGTG
TTTAAAAATGGGGCAACTTGAAAGCAAGTGGAGGAAAGCAACTGCTGTTAAAGATGGTTA
AGTATAAATGGGAAATAAGTTTTTCAGGATCTTGGGCATGCACATGCACCTGGCATGAGT
TTAACCTGTGGGATCTGGGACTTGACCAACCACATGGGAGTCCAGCACAGCAACATAGCC
ATTACACTAACTGCTGGTACCAATGGGAACTAAGTTTTAAAGTCCCATTTCATAAATTTT
TCAGGAAGTTGAAGGAGCACTTGAATACTATGCTAATGCAGTTAAGTCTTTCTGTGGTCA
TTTACTTCAGATATGATTTTAAAAACTGGTCTTCTGTCTACTGCGTTGCTCCTGCTCCTA
CATTCCTGCATCAGTAGCTCTGCATTCTGGCAAAAGGCCAAAAGCCAGGTTCAAGATTGC
TGCTTCCTAATTGAACATTTGTGGGCTTAGAAACTGTAGATAACCTAGAATACCTTGTCT
CCAAGGAATCTTAAACTGAATTTAAAATGACTCATTTTTGTCAAGTGGTCTGAATTTTGT
AGAGGCTTATGTTTTATTAGTTGGGCCCCTAACCAGCCCCATTGAGAAGGTGGTACTATG
CTTGGTTGTATATCCTGCAAACTAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved