Tupaia_belangeri Locus Mono:175:SNORA16
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:175:SNORA16
Tupaia_belangeri
Mono:175:SNORA16
GeneScaffold_1330
SNORA16
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCTTGAGTATACAGAACATTCTGAATGGCCATTTCTGAGGTGCTCAGGCTTGTTATG
TTTAGCAGATAGGAGTCAGAAACTATCATTTCAACTCCGAAGTAATCATTATCTAAATCG
GAAATGCAAAATGATAACTTAAATACACTTTCTACTAAGCACTTTTAGTTTGAGACTCAA
CAGTACCTAAGCATTAAGTAGAGGACAAGAATAGCTCTGTGTTTTCTCATAGATGTACAT
AATGAGGCATAAAGAAGCTAAGTACTTTATCCCGTATCACTTAGGCAGGTGGAAACCGAA
GATGTAATTTTTCCAGATGAACTCCATCTCTGATGGCCTGTCTCTTATACCATGTTGCCT
TCAAATAGATTTTGAAACTATGGATCAGAATTGCTATAGCACGCCGCCCTTATCGAAGCT
GCAGCTGCTTCCGTGTGGCCGCTGTGGTCAAAGAGGAACCCAGAGTTTTCCCTGGTGGTC
GCTGTTCTGCTTGGTGGCCGGTCTACAGCATTGTGGGGAAAGACAGGCGTGGGCGTGTCC
CCAGGGCCAGGCAGGCTCGCGAGGCCGGCTGGGGGCTTCGCACGTGGCCTTAGGGACTCC
GACCCCCGCGGGAAGGTCATTCTGGACAATCCTGCTGTCTCCGCCCTGCGGGGGGGGATG
AGCCGGGACAGTAGCCATGTCTCTGGAGGGAGGACCCCGACTGCAGTGACTAGTGACAGA
CAGCAACAGCCCTGGCCGGCAAGGCTCCCAGCAGGCAGGTGCAAAGCCATCTGGGGCCCT
TTGCTCTGGGAGCGCTGTGACCAAAGCCTGCGTTCCCTAGAGCCGGCTCTGCAGAGCAGG
GAGACACAGGAGGGGAAAGCATAAGGAAAAGCAGAATTTCTTGTGGTAACAGCTAATGTT
GTAGCACTAAGTGGCCACTAAAAAAAGACTGGTAAAAAANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAGTGCCCAAAATTTCTGAGAGGAGAATGGAGGAGAAGGGAT
TGCAGTTGTGGCCATCCCCTTTTGGAGGTGGGGTGATTTCTCGCTCTCTGTCTCTCTGGC
AAGTGCAAATTTTCTCTCTCTCAAAAAAAAAAAAAAAAAAAGAATTTAAAGTTTTATCCT
TCATGCAGATGAGAGCCACCAAAATCTAATCAAGGAGAAAAATAACAAATCTGGACTCTT
TCAACAAATCTGTATTATTTCAGAATACGAAACTGCTACCTTTGTAGGGAAGAGAAGAAA
ACAAAGCAACTGGTACCAGGGAGACAAGAAGAGGCTCCTAAGAAAATGAACTGCATTGAA
CAGAATCTGAACTATGGTGGTGGTGGTGGGATAACTGTCCTGGGAAATATTCCTGAGGTA
TAATTTTAGAGGAAAGCTTAGTGATTTGTTTGATGTGCATGTGTGGGGTAGTCTGTCTTA
AAGATGTTCTACCTTTGAGCAAGCCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved