Tupaia_belangeri Locus Mono:184:SNORA57
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:184:SNORA57
Tupaia_belangeri
Mono:184:SNORA57
GeneScaffold_5213
SNORA57
1001..1149
1536
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTTCTTGAGATTCT
GGTAAGGGATTTGAGACCCAAGGTTGTGAACTACCGGTACTGTGAGGCCAGCGGAGTTTA
GGAACGAATACATTGACAGATACGCCTGCACAGTCTGGAGTGTACGAAAGAGAGGTGTTG
GCTGCTCTGGAGGGATGATAGTCGATGGATGGGTCTGGTACTCACGCCCGCTTCTTGAGA
TGGTGGCGCGTGATCAGCCCTTGGTCTACCACAGCCCCCACCACCTGGTGCCTCAGTCGC
CGCTCCCGGTTCAATACCCGCCTGCGCTTGAACAGCTTCTTCTTCAGTTCCTGTGGGGAA
GAATGATGAGAATCAGACCGAGGATGCACACCGACACCCAGGACCACCGCACCCGTCGGT
CCTAGCCCTCCTCGATCCCATTTCGGCAAGAGAAAAGGACTCCGACACGCTTGGGGAAAG
AAAGTCGCAGCAGGCTGTCACCGTTCGGGGCCGGTTGATCTTTCCCCCTGGAGGACCCAT
GGCTGCACTCAGACGCCTTCTCCCGGTCCGCACTTCCGTTCCACGGGAATCCGCCCCCAT
CCTTCAGCGGGCCAATCACAGCTGAGGGGCGGGCTGGTTTCCCAGGACTATATAAGTGAG
CTCGGTTCGGTGCCAATTCTTTCCGAGGACAGCGGCTGTTCGAGATGGTACGGTCAACTT
CTGGTGAGGGTGGCGGTGGCTTTAAGCGGGGCTTGCGAGGCCCTCCTTTTCTTGGCGGGG
AGTGGGCGTGCGGTCCCGCTCCCTGTTATGTGTGGAGGCAGAGGGAAGGGGCATCAGCCC
GCTCTCAGCATGTTTTTTGTGCATCGGCTTTCTATGCGAAGATTATTCTTCTATAGGCCG
GGCATGCTTTGAGATAACCAGATCTGAAACTAATAAGATTTTATTTGAGGGCTTAGGCCT
TTGCCTTTTCTTACAGGCGTGCCTACGCCTCTTCAGAAACGCGAGCTGTAGTATCCTCTT
CTCTTCCGCGTCTCTTTGATTCCAATAAAGGCCGTATATCCGTCTGTGTGCGCGTTCTTT
CTTGCGAGGCTGCAAGGTTCGGGAAGGCTGTAAGCGTTCTCTGCAGCGCGGAATTTGCAG
ATCTTCCCTGGGCCTCAGACCCCTGCTGGAGTGCGAGCGACATTGCGTACAAGGTTCTCT
GGCCGACCACGCAGGGACCTCGGGATGGCTGCGCTGCACCGACTGCTCAATCGGTTTCAA
CCCTGGTGTCGGGGGCGCGCCGGGCCTTGGCTGGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved