Tupaia_belangeri Locus Mono:133:SNORA51
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:133:SNORA51
Tupaia_belangeri
Mono:133:SNORA51
GeneScaffold_2280
SNORA51
1001..1130
2130
TCAAGCCAGCTCTGTGGCCTAGTGGTTAAGGGAGCTAGATCCCACATAGCTGACTCCCT
TTCGAATCCCAGCTCCGGGAGACTGGAAAAACACACCAGTTGAGTTTGTGTGTGTGCCCC
AAACCCCGACAGGATGGAGAAATAGAGGAGAAGGAATTGCAGTGTCACAATGCCTTACTG
GGGATGCTTTCTCCTCCCTGCCCACCCCCCTCCACCCATCTTTCTCTGGCAAGCACATGT
GCCCTATGACAAAAACCTAAAAAAGAAAAAAATAAGTTACCAGACAAATGAAACATAAGA
ATGAAAATAAAATCAATCAATTGAAACAAACCTAGAAGTTTCATGCATAATAAAATCAGT
AGATTTGGACTTTAAGACAATAACTATAAATATATTGGCACCAGCAGAGTGGTATAGTGG
TTAAGGGCACTAGACTCCCATACGGCTGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGACATAGTCATTACGCTAACTGCTGGCCCCAGAACTTGTATTTTTTAA
AGAGATTTTTGCTATAGAGTGCGTGCACTCACTAGAGAGACAGAAAGCAAGAAATCATCC
CCAGGGGATGGCCACACTACAATCTTTTCTTCTCCATTTTCCTCTCAGGATTTTGGGCAT
GCATGCATTCAGGCCTGGCGTGAATTTCAAGCTCCTGGGTCCAGGACTTGAACCACAGTT
GGCCATGTGGGAATTCAGCATCTTAACCACCACGCCACTGGCTGGCCCCCAAACTGAACT
TCTAGAGACAATAAAAAACAGTGTTTGAAATGAAAAATACTGGCCTACTAGTGCTTACTA
CAAGCTGTGTTCATACACTGACTGTACAGAAGAAGAGGCAGAGTAAACCTACCCCAAATA
CACCTCAGCACAAGCTCTGTGCCTAGACTGTATTGTGAATGAGAGACATGGGGGAAAAAA
AGAGAGAAATGAAAAATATCATGGAAGGGATTAAAAGCAGATTAAACACTGCAGAAGAAA
AAATAACCTTAAAGACATAGCAATTATCCAAAATAAAACACACAGGGTTAAAAAAATAAT
AATTTAAGAGAGCATCACAGAGCTGTGGGACAGGTCCAATTTTTTCTCTTTTAATTGTAA
GGGAGCAACAGAGTGACAGAGAGACTAAGAGAAGGAGGAAGCACCCCCACTAGGGCATGT
CCCCACTATAAACTCTTCTCTACTTTTCCATCCTGTCGAGATTTGGGCATGCAAACACAC
TCACCCAACTCTTTCTCAAGCCACTGGAACTGAGGTTCAAACCATGCTTGGCCATGTGGG
ATCTGGTTCTCATAACCCTAAGTGATGGGGCCAAATGACTTAATATATATGCAATAAGAG
TACCAGAAAGAGAAGGAGGAAGACAAAAAAATACACAAAGAACCTGGCAATTCCCAAGTT
ATTTGGAAAGCTAAACCTACATATACAGTAGCTCAATAATTTGAAGCATAAAAATTGTCA
AAGCATATCATAATCAAATTGCCTAAATTCACCAGCACACCACAATACCAGAGAGAAATC
TGAATCAGAAAAATGGAATGAAAACCACCACAAATGGTAGCCACTTGAAAAATATATGAC
TTTTTAAATGATCTTTTTAAGAAACAGTAATTTATTAGTAGTAGTAGTAGTAGAATTATT
ATTTTAAATTTGCTACTGGGTATGTACACTCACCAGAAAGGGGGAGAGAGAGAGAGAGAA
AATGAGAAAGCAAGTGCTGGGTCTGGGACTTGAACCATGGTCCATCATGTGGGAGTCCAG
TGCTTCAACTACCATGCCACCTGCTGGTCCCTTTTTCTTATTACCTTAATCTCTTTAATA
GATACATAAAGAAAGAAGTTGGTTCGGAATGGACAGGGTTAGGGGAATTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved