Tupaia_belangeri Locus Mono:17:SNORA48
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:17:SNORA48
Tupaia_belangeri
Mono:17:SNORA48
scaffold_132137
SNORA48
1001..1121
2121
CTGTTGAGGGATATCTCTGGCTCCACGCTTTTGTTTTCCTGGTGTGACGGGTTAATAGA
ATTAGAGAGAAAAAGCCGAAGATGAAAGGAGGCAGAGAATTTGGGAATCANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACGTTGGAGTTTAGT
GACGTAGCTATTACACCATTTGCTGGTCCCCAATGATAGTATTTTTGAGCAAGAATGGCA
GAAGTCTTCCTAGTGTTCTGATAGAGGGAAAGCTTCTAAACATCTCTGAATTTGGCCAAA
CTCCTTTGCAGGATGTTCGAATCCCTTTAATCTCTCCTTTTCATTTTTCAGACAGTTTCA
TTCCAAGATAAGTCAAGATAGGTCTTTGTATCTATTGGGTCGTAGAAAAGTCATAACACA
TTTTTACATGGAAAAACCTAGAAAAAGGTGCCATGGCTTTTCCAACAACCCAATGGTATC
TTCACCAATAGTCAAATCGTAGATAGGGTTAAAAAAAAAAAGTCTGGAGCCCGGAAACCA
AAAGACAGACCACCCAACAAACCAAATGAACAAGAGACTTGAGTAGACACTTTTCCAAAG
ATAGACAGGTGGTTAACAAGCATGTGAAAAAAATGCACAGCATCCTTTAGTCATTAAGGA
AATAAGATCCCACTTCACGCCCATGAATATGGTTATGCCCATCAAGAAACTGAAAAAGCA
CAAGTGTTGGCAAGGATGTGGAGAAATCAGAGCCCTCACCTACTGCTGGTGGTAAGGGGA
AGTGGTCCTCACTGTGGAAGGCAGTTAACCATTCCTCAAAAAGTTAAAACAGAATTACGA
CAAGACCCAACAATTCTGCTCCTCCGTTTAAACTCGAAAGATGTCCCTGGCCTGGGTAGA
GTGGTGGCCATGTCAGATCAGCCAGGAACAAAACAACCTCTTGTTCATCCCAGCTTGACT
TTTGGTCAGTGGCCTTGCCTGATTCATGACTTGGACCCATGGGGGTGGGGTGGGAGGGAG
AAGATAGAAAGAAAGACAGGAAGGAAGGAAGGTGAAAACAAGTGCTTGTATACAAACGCT
CATAGCAGCAAAATTCACAAGAGCTGAAAGGAGAAAATAACCCAGTCTCATCAACAGATG
AATGGATAAACAAAATATGGCATATATGGGGGCCAGCAGGTAGTGTAGTAGTTAAGGCTC
CCACATGCTGTACCATGGTTTGAGTTCCTGATTTGGCAGCCTGAAACTCACAATAGGCCA
CTGTGTGTGTCCAAAATCCTGGGAGAAAAACAGAAGCAATTGCTGCGTGGCCATCCCTCC
TGGGTGTGATTCTCACTTTCCCTTTCACTGTCTCTAGTGAATGCGCGTGATCTATGGCAA
AAACCTTTTTTTAAAAAAAAATGGCGTATCTGGGAATAAGTGGCATAATGGTTACATCAC
TGGACTCCTACATGGCCAGCCATGGTTCGAGTCCCAGACCCAGTGGCTTTAAACCCACAC
TGGGTGCATGTGTATGCGTGCCCAAAATCCCAAGAGGAGAATGGAGAAGGGATTGTGGTA
TGTCCATCCCCCCGGGGGGGGTGATTTCTCACTTACTGGCTCTCTTTGTCTCTGTCTCTC
TGGTGAGCACACACACCCTATAGTAAAAAGTCTCTCTACAAAAAAGGCCTATCTGTGCAA
TGGAATATTAGCCATAAAAAGAAATTAGTGATACATGCTACAACAATGCACGAGCCTCAA
AAACATTAGGCTACATGAAAGAACCCCAACATATTTATATAATTCCTTTCAGCTTTCTAG
AGAGCACTGTGCTCTCCAGAGAGAGAGACAAAGAGACAGAGGGAGGAGGAGAGGAGAAAG
CACACACACACACACACACACACATACACACAGGCACGCATGCACACACCCAGCATGGTT
CTCAAGCCACCGGGTCCAAGACTCAAACTGCGCAGTTGACCATGTGGAATCTGGCTGTTT
CAACCACCACATCGCTGACTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved