Tupaia_belangeri Locus Mono:126:SNORA63
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:126:SNORA63
Tupaia_belangeri
Mono:126:SNORA63
GeneScaffold_252
SNORA63
1001..1130
2130
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGCGTTTAGACCTGCACTCGACTTTAACTGGCAGGTTGGGTGGTTTC
GATATGGCTGTGAAGTGCTGTGTTGTCCTCTCCCCTGCCGAAAGCAACTGTCTCCCACAA
TCTCTGTCTAACTCAGTTTATAGTAAGACAGGGACGCTTGGTCTCAAACACTATTCCTCT
AAGTGTTACGAAACGGCTACCTATGCTTTGTGGATTTGCCCACATATCTAGTCATGTTCT
CTCTTTAAAGGTTCGTTCCCTCCTGCTTCCAGGCTAACCATTGTGTTGGAAGCTATCTGG
TTTGTGAGAGATTCATTTCAAATTCTGGGCAAGAAGAAAGAATTGGCCCTTGAAAGGATC
ACTGTTTTATAATAATTTCGAAAGAGGGTAATGTTTTTCTAATTGGTATTCATAAAAACT
GTAGCCACTGTTTTATTTTTTATCTTTTTATTTAAGCTCTGTGCTAAAATTGCATAAACT
ACTATCATGTCTTTATATTTCTAATAAAGCTAACAGGAGAAAAAAAAACAAAAACCAAAA
AACAACTGTACCAGATAAAACAAAACTGAGATGGGGCCAGTGAGTGGCACGGAGGTTAAG
GTAATGGCCCGCACATGGCCCACTAGACAGTGGGAGTCCCAGCCCAGTGGCTTGAAACTC
ACGCCAGCTGCGTGTGCGTGCATGCCCAAAATCCTGAGAGGAGACCGGGAGAAGGGATTG
CTGCGTGTCTGTCTCCCGGGGGGTAATTTCTCACTTCTTCTCTCTCTCTCTCTCTCTCCT
CTTTCTTCTTCCTCTCTGTCTCTCTCTCTCTCTCGTGAGCAGACAGTCCCCATAGCAAGA
AACTAAACAAACTTTTGTACAATCATATCTGCATTCAAGCCGAATTAATTGAATGAATAA
ATAATCGCTACCAGTGGGTAGGGATGAGAGCTACAAATCAGATGACGTTTTTATTTCAGC
TTTCATATGAATGAACACTTTCTCCTCTGAAACCCTGAAGGGAAGGAGGCCGTGGGTTGC
GGGTGGGAGACTGACCCGTCGGGCTGCTGTGGAGCACGGGCAAGGGGTCGCCAGCTTCTA
AGAGAACGTGTGGGCAGGTTCCCCTTCCCATGCGGTGAGCGCTGCCCTTCCCTGGTTGCT
AATAGCTGTAACCATGCACCATTTCCTCCGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved