Tupaia_belangeri Locus Mono:161:SNORA67
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:161:SNORA67
Tupaia_belangeri
Mono:161:SNORA67
GeneScaffold_3767
SNORA67
1001..1123
2123
AGACAAACTACTTAATCTGGGGACCTGCAGTTGGCGTAATGGCTACGTTGCGGGACTCC
CATGTAGTCGATCACAGTTCAAGTCTCAGACCCGGTGACTTAAACTTATGCCTGGCGCAT
GTGTGTGTGTGCCCAAGATCCCAAGAGGAGAATGGAGAAGGGATTGCGGCGTGGCCATCC
CCCCTGGCAGGTAATTTCTCACTTTCTGCCTCTCTGTCTCTCTCTGACTTTCTGGCGAGC
GCACGCGCCTGATAGCAAAAACCTCTCCAAAAAGCCCATTGAATCTGATCAGTGCCCACC
TGGTAAGAGTTTTCTTAGTTTCTGGAGCTGCTTAGAAATTCAGGATATAGAATTAAAAAT
AGCAATAGCCAATTATATTTATAAACAGAGTTTACTAGATAATCCCAACTGGTGTCCCAC
CTTTCTCTAGCCCTTTAACTGTGCATGCTCCACCAGCCACCCTACCTCAGATCAAACATT
TCCTTATGGCATTGTTCGGGCAGGGAGGAAATCCCCAAACTACTGAATTCCCTCCCAAAA
CACAGCTGCCTTTTCTCAAGACATGCCAAGGTTGCTGAGAAATATTCGGGATGTCAAAGT
AACGTTCTGCAAACTCAGCAACATGAGTGTCACTTTATTTTCTGTCTTATTTTTGCAATG
ATTGATTAAATGGACACTAGGAATTTGGGAGTAACAGGCTTTCTCACCCAACCTCTCTGT
GTTCCTCTGACCATGAGCAGATTCTATCACAGGGACATGAAATCTCGGCTTGGAAAAACC
CTCAGGGGTCACGTGCTTGTTCACTCACACACCGGACCTGCTGGGTGGACCCTGACATGG
AGCCACGTGTGACTTGCCTCGGCCATGGCTCACCTTGTCCAGTGTGTCATTCAGGGCATC
CAGCGTCTGTATTTTGACAACGTTTGCAATGGCACTGTGAAGATGAAAAAAACAAAACTT
CAAGTAAGACCTAAACACTTGCCCACTAAAGAGGCCAAATGATCCAAGTGGCCCTCTCGC
CCTCTCAGGGCAAGTAGCAACTTGGAATAAAATCCAGCTTGCCTGAAGTCTCTGGGGGCC
AGGGGATGCTGATTTCCTTTGCCTTCCTTTGGCTGCCTATATGTGTGAGAACAATAAAAA
TATAAATAAATAAATAAAGAGGTTAAATGATTTATTCAGTGGGTTGTCAAGCTTTCACTC
TGCTTGGCAACATCTAGAAGACTAAACTGCCTCTGTGTACCTACATGCCACAGCAAGTTT
TGAAGGCCAAGTTATCCTCATTATTATTTTTAAGTTTTAATATGAAGCATAATGCACATA
TTAGAAATATATAGCTTGGTAAATCTTCACAAGCTGAAAACACTACTCAAACTGGTGCCC
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTTAAGATGGGCCAGT
GGGCCTGGCCTCCCCTGTGGCCTCAGCCTGCTAAGTACCAGTGTTAACCAGCATGTGCTA
CCATGGCCAGGACTCTATGATATGTGTGTGTGTGTGTGTATATATGTATATATACAGAAA
GACAGAAAGTGAGAAATCACCTTCAGGGGGGATGGCCACACCACAGTCCCTTCTCCTCCA
TTCTCCTCTCAGATCTTGGGCACCCACACACACGCGCCAGGCGTGAGTTTAAGCCACCCA
GTCTGGGACTTGAACAGTGGTCGACTACATGGGAGTCCAGCGACATAGCCATTACACCAA
CTGCTGGTCCCAAATAAATAAATAAATTAATTAATTAATGAACAAATGTTTATTAAAAAC
TATTTAAAAGCAACTGGGTTTTTAAAGAGGATTCCTAAGGAGTAGATAGCTATACTACTC
TCTAGCCAACTCCTACTTTTGAACTGCTTATCAACTTATCTCTGGAAACCATCTGAAATT
ACTAGTCTCTGAAGCACCCTGTTTTATACTACTTGGAGGAAACAGTTGTGTCTGTTTCTT
TCTTTTTGAAATGCACTCATTTCCCTTAACCAAGGTGGAGTGTGGCTGACCATTTATGTA
TCTGGTCCAGCCCGCAGCTCTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved