Tupaia_belangeri Locus Mono:140:SNORA57
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:140:SNORA57
Tupaia_belangeri
Mono:140:SNORA57
GeneScaffold_3185
SNORA57
1001..1140
2140
CTTATTACACACAACCCAACTAGTGCAACCTTTAACAGATTTATAGAGGAACTCAAGAA
ATATGGAGTTACTACAATAGTAAGAGTCTGTGAAGCCACTTATGACACTGCTCTTTTGGA
GAAAGAAGGCATCCAGGTTCTGGACTGGCCTTTTGATGATGGTTCATCACCATCCAACCA
GATTGTTGATGACTGGTTAAGCCTTGTGAACATTAAATTTCGTGAAGAACCTGGTTGTTG
TATTGCTGTTCACTGTGTGGCAGGTCTTGGTAGAACTCCAGTGCTTGTTGCTCTGGCATT
AATTGAAAGTGGAATGAAAAATGAGGATGCAGTACAATTTATTAGACAAAAGCGGCGTGG
AGCTTTTAACAACAAACAACTTTTGTATCTGGAGAAATACCATCCTAAAATGCGACTGCA
CTTCAAAGATTCCAGTAGTCATAGAAACAACTGTTGCATTCAATAAACTTGTCTGCCTGA
TGCTTTTGCCTTGGAAGTAGAATTTAAGACAGGATCTAATTTGCCATACATATTAGCTAA
TATATAGGTTTAGGGAATAAGTCAAACGAAGATTCCTTTGAAAAGCCTTGACAATTCCGG
CCTTTAAGTTTGACTTACTACTATTCCCATACCATAAACAGTATATAAGAATTTAGAGAG
ATTAGTTGCCAAGAAACCTAGCACAATACTTGTATAATTTTAGAAACATACAGAATTAAA
ATCCCAGGAACTATGAACAGCATTCTAGACCTTCTGTGGTTTATTCCTTAAGTCACTTCA
AACATTGCAATTAGGACCTGTGTGGTTATTTGCCTGTTCCTTTATGTTTACCACCCTGCA
TATGTACTGGTATACATCAGGTATGTGAAACAATTGGCTTTGTTGGATTCTTAACAGGAC
TTGTGATTATTTAATATCTTTCTAGAAATCTCATTTTGCATTTTGTGTAAAAATACCGTC
ATTTTGGAAAAGTCATCTTCTGGTTGAAAGTTCATCCCAGCCCTCCTTTACTTGGCAGAG
AGTGGGTCTGTGGTCCTGCTCCCTGTTATGTAATATATGGAGGAAGAGGGAAAGGGGCTC
CAGCCCCCTTGGTGTCATGCCTTCAGTGCCACCGGTTCTATCCTCAAGCACTGGGACACA
GGGGGTAAAAAAAGAACATCTCAAATCCTCTCCTCTGTACAAAAGCATTAGTGTCTTCAG
ACAAAAATAACCTTACAGTGCCCTGAAGACAGAATAGGAGGATGCTATGAGATATTTTTA
GTAAAATATTCCTTTTGTCTTGTACAGGATGTATAGAATAGATGTATAGAATACCTTTTT
TTAAGAGAGATTTTTGCTATATTGAATGTGCACTCACTGGAGAGAGAGAGAGAGAGAGAG
AGAAATCATTTCCCCTCTAGAGTGTATGGCCATATCACAATCCCTTCTTCCCCATTTTCC
TCATAGGATTTTGGGCATGCATGCATAATGCACCCAGTGTGAGGTTCAAGCTTCCAGGTC
CAGGACTTAAACTGCAGTTGGCCAAGTGGGAGTCCAGCGATGGAATCATTACGCCATCTG
CTGGTCCCTAGAATAGATCTTTTAATTGAATAAATATTTTTTAAAAGGTAGAGAGAGATG
CTTTGTATTTGTAGCTGAAACAATGTTTAATTATAAAATTCCTGAAAATCTTGTAATTCA
TTCCCATACCTGTGAGAGGTTATTAACTATTATTTTCATTTAAAGTATGTTTTTTTGGTC
TTCCCAACCAAGAAAGAGTGGGTTTTTACTGATGAATTTATCAGAGGTTTAATAGTTTAT
ATAGTTTTTGAACTGTTATCTTAAATTTGGATACTTGCTAATTAGTTTTATTATGTGACT
GGTAAACTGGTGATGTGTATTAATGTTAGAACAAACATATATTCATACTATTTGGGAATA
TATGGTTGTAATTCTGTGGGAGAAATAATTTGTCAGTGTTTACCATTTGCCAGCTAATAC
AAGAGCTTTAAATAAACACCTGAAGAAATAACAAATTGTAAAAGAGAGAGATTTCTAAGA
CGGTATAAATATTGCTAACACCAGTAAAAGTAGAAACTAATACATTAGTAGAGACAAAGA
AGATTGCTATTTAAAAGTTTCAAAAGTTTGAATTCACGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved