Tupaia_belangeri Locus Mono:179:SNORD17
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:179:SNORD17
Tupaia_belangeri
Mono:179:SNORD17
GeneScaffold_674
SNORD17
1001..1236
2236
TGTTACATTAACCAGGATATTTGTCTCTACATTAAGCATTCACTGTTTCTGAAAGGTAC
CCTCCTGTGTAAATGGTGAAGAGTACAAGGGCAGATGGCTCCAATATCAGGACTTTCACT
TTGTCTTTTAAAAGGAGTGCTAAAAGTTGGGTATTGTCTTGATGGACACCAAATATCTAA
GCAGGTGGTGATACAGTTATGTAATATTTACACTTGAATAATTTGAATTTATTCAAACAT
TAGAAATATGTTCCACCTCAAATTCACAACAGTGAGTCCAGCCATGAAGCAGGCAGCTCT
GTCCATGCTAAATCTTCTTTTCTTTTTGGTAGTGAAGGTAAATTTTTTATGTTGAAGTCT
ATTTCCATTTTCGCTTGGTTTGATCATAAAGGCAGTGAATGTTGCTAAATATTCTCACCC
AGAGGAGGGATATAGAGCATTTCTGCTGTCAGAGGGCTTTTGGACTTGACAACCTGTTAT
ACCAGGAATTTGGGGGAAGGAGTTTTGATGGAATTGGATAGAAGTAAGGGGCTTAGCTCT
GATTTGTGGAAATTAGTTTTTCTTTTAATTTTTGCCATAATGTGCAAGTGCTTTCTGGAG
GAGGGAGAGGAAGTGAGAAAGCACCCTCTAGGGTGCATGACAACACAACAATCTATTCTC
TTGGGATTTGGGGCACACATGCACATGTATTATTCAAGCCACTGCCATGCACTTGACCAT
GTGAGATCCAGCAGCCTTACCCACCACACTACAAGCTGGCTTGGAAATTTAGCTTCTCTG
TTTCCCAGTTGGGGGAGCGACTTTGTAGTGGTACTGTTAATCCCAATAGGAATTCTGTGC
TAGAGATCTCACAGTCATAGTCATTCTGCTTGTGACTCATCTGAAACACTCAGATATCTA
GTTGGTAGATGGATTTCAGGTTCTATGTTAATCATTTGAAACTAAATTTGTTTAGTCTGG
TTCCTCATAGGGATTTGACTACTGCATGGGCTTGCATCCTTGTGAAATGATGATTCAGTT
TATCCATTCGCTGAGTGTGCTGTCCTGACCTCCTTCCAAGTCTCAGTTCCTGTTCTAGGA
ATGTGGGGCCACGCAGCCTCCAAATGCCCTACAGTCTGCAGTGTTCTACTGTGGGCTGTT
TGTGTGTTGGTAGGCTGCTGGCAGGAATGGTTGGTGTCAGCAGGGATGGGGCCACTTGGT
CCCATCCCACCAAGATGAGTGGTGGAAATCTGATCACTTGCTGCAGCCCTTTATCTAGCT
TTCTGTTAAGCTTAAACCAGGCTCATTCCTGAGTGTGTTTTGTAGTTATTATCTGTTAGT
AAGTAGGCAGATCTAGAAGTCCTTAGATCTTGAGAACTAAGATGATACTGCTGACCTGAA
TTATGTACTCGAAGAAGAGAATCCACGGGGAGAGGAGAGACGAGTAAAATATCCGTAAAA
GCAGAGATAATAAAACCATGTTTATAGTTGACTCATCAGTTTTGCATACTTGGTTGCTAC
AATAGAAAACTTGGATAGAATACAGATAATAGACTTTGGTTGTTTTCAGGGTGGAAGGAA
TCAGTAAATTCAGAGTACTGATGCATTGAGCTCTTTTAGCCATTCTTACCAATACTGAAC
CAAAAAGGGGGTTGAGAAGGGTGTGGTTAGCATTATGGAGCACTTCATTTCTGAGTTGAA
ACAGCAAAGTAATGTTTTATATATAGTGTGGATGGGTCTTTTAGGCTTCCTGAAATTAAT
GCAGATCTACAGTGTTTGTGATAGGACATTTTTTATCCTATTTCCTCAATGAAGTTAGAA
TAGATAGTGAAGGTATGAATATCTTTCCAGTTGAACTATGCCCTGCTTTTGCTTTCTGTG
ATCAAAGTGAAAAATCTTGTCCTGGAGGTAGTCTTCTTGCCTCTCCTGGCTCCATGCTGA
GAATAGACCCTTTATGGATGACTTGTCGTGGCCCTCATCCTGAGAGAGTTCTTAGTTCCT
TGGCACTAGAGTGAAGGATTTAGGAAAATTATTAGACGGGAATGCAATAGTTGAAGAGAA
AGCCCCATTTGCGAAACATGCTTATTAAATAGCTGTTCCGTGTCAGAGTTAAAGTAGCTT
TTATTTCTTTGTCTTCTCTTTTTGTCCGCATGGCACTAGTCTGAAAGTCTGCAGTCACTA
TAGCATTTATTGTACATTATGTGTTTTCTCTTGTACTCCTGTGGGTTTTGGATTTCAGAA
TTTTAAAAAGTCTTTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved