Tupaia_belangeri Locus Mono:185:SNORA15
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:185:SNORA15
Tupaia_belangeri
Mono:185:SNORA15
GeneScaffold_565
SNORA15
1001..1139
2139
AATAAGGTATCTAGGAATAAACATAACCAAACACGTGAAAAAAACTCTATAAGGAAAAC
TATGAAAAATTGAAAAAAGAAATTGAGTATGATATAAAAAAAATATATAAAGTCATCCAG
TGTTCTTGGACTGAAAGAATCAATATAACCAAAATGTCAGTTCCACCCAAATTAACTTAC
ATATTTCAAGAAATTGTGATGCAATTGCTAGAGACATTCTTAATAGAGAAAAACAACCAT
AAAATTTATCTGGAATCTTAAAAGACTCTGTGTCACCAAGGCAACACTGTGCAAAATGGA
AAAAGTAGATAGCATCTCATTCTCTGACCCCAAAACATATTATAAAGTGGTGGTAATCCA
TACAGCATGGGACTGGCACAAAAAAACAGGCATGTAGACCAATGGAACAAAATTGAGAAC
CAGAAATGAACTCCAAAACACACACTCAGTTATCTTTGAAAAAAGAGTGCAAGATAGTGA
GAGGAAAGATATTAAGGAGGAAACTAGAGAGGCAAGACATTTACAGGACAGGAAAGGATT
ACTGTCTGTTGATTATAACATGTATAGTATCCTCAACTGGGGTGGTATGAAGTGTATTCA
TGTTAGGAGAATTCACTTTACAAACTAGGTGATCTACAGTGATTGAATGTATAAAAGAAA
TTAAAATTTAAAAGTAATAAAACTTCTAAAAAGAGTACCAACAGTGAAATGGAAAAAAAG
TAAATCTTGTCAGCAAATGGTGCTGGAAGAACTGGGTATCTATCTGCAGAAAAGTGAATA
TAGACCTCTGTCTCTTACCATTAAAAAAATAAATTCAAAATGCATCAGAGATTTAATTTT
ACAGCCTCAAACTATAAAAATACTAGTGGAAAACTCAGGGGAAACTCTGGAAAACACTGA
AGTGGGCAAAGGTCTTATTTAATAAGACTCCTAAAACACAGGTAATAATCCCCAAAACAG
ACAAATGGAATTACATCAAGCTGAAAAAACCTCCTCTCAAGGCATGGCTGAATGCTGTCT
TCTTTTATCAGTAGTTTACAGAGTCAGATAGCATGTAAAAGTAACATCTTCCCTCTGAAG
TGATCATGATACTGTGCATTGTTTTTTCATAGCATATCTTTATTAGAAGTGAATACAAAT
AAATAAAATAAAAAACTTTCTCACAGCATAGAAAACAAAGCATAGAGTGAAAAGCCTAGC
CACAGAATGGGAGAAAATACTTAGAAATAATTCTCAGAAGAGATTGATAACCAGAATATA
CAGGGATCACAAACAGCTCACCCATAACAAAATAGACAATCCAATTAAAAATGGGCAAAT
GAATTGAACAGACAACTCTCCAAGGAAGACTTATGAATAGCCAAAAGACATACAGAAAAG
TGTTTGAAATCTCTTGTCATAAGAGAAATGCAAACTAAAACCACAATGAGATACCACTTA
ACCCCAATTGGAATGGCTAGGACAAAAGACAAATAACAACTCGCATCTCCTGCCCCCTGG
CCTAAAGGATACTGAGGCAAGGCAAGTCTCTGGCTCCTGGCCCCAGTTCCAGCTCCTTCA
ACCCCAAAGTCCCCTCCTGTCAGCAAGAACTGCGCCCAGCTCCCCAGCAGAGCCCATTTC
CATCTCCTGCCCCCCTAGCCTACAGGACACTGAGACAAGGCCAGTCTCTGGGCCCTGGCC
CCAGTTCTATCCCCCTTAAGCCCAGAGCCCCCTCTTGCCAGCAAGACACCAGAATAGAAT
ACTCCTCCAGTGTGGACCATAGCAGAAGAAAGACTTCGGCACACATCAGTCCACAGCAAA
AGGGAAGCACACTTGTTCCCAGTCAAAGAAACATCTTCCATAAAGGTATCCAAAAGTGAA
TACTTCTCCCAATGGATACAAGTAGAAGAGCCTCAGGTCTGAATAAACCAGGAAATATCT
CTCCATCAGAGGAACACAATACCTCCCTGCCATCTCTTAGAAAAAAAAAAAAAAGATGAT
GTGGGACCAGCAGTTAGCGTAATGGCTATGTCACTGGACTCCCACGTAGTTGACTGCAGT
TCGAATCCCAGACCTGGCAGCTTAAACTCGCGCCGGGTGTGTGTGTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved