Tupaia_belangeri Locus Mono:117:SNORA51
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:117:SNORA51
Tupaia_belangeri
Mono:117:SNORA51
scaffold_14580
SNORA51
1001..1124
2124
TCATTGTCTCTCCTCTCTTGCATCTCTGTTAACTTCATCATTATAAATATTTTAAATTC
TTTATCAGGCATTTCCATGATTTCCACTGAACTGTTTGTAAATGAAGAGGATTTATTCTT
TTCCCTTGGGGGGAAGGTATTATCTTGGTTTCTCATATTTCTGGTGCCTTTGTGGTGATT
TCTAGTCATCTGATGGGTTATATGCTTCTTCCTAATGTCTAGAAGTTCAATCTGAGCATT
CTGGGGCATGCAGGAGGACATGATCTACAATTTCTTTGCTGTTCCATTTTTATTCCTTTG
TGCAGCAGATCCAGTGGGTATTGAGGAATATGTTAACCCTAATAGTATCTGGATGTTTGG
CTATAGTTCCCTTAGATCTGTCTAGACACTCAGTGAATGGAGACTGAGCAACAATGTGGT
GAGGTAAAAGAAAAAGAATAAAACATAGAGAGAAAAAAATAAAGAAAGAGAGGGAAAAAG
AAGAAGAAGAAAACAACCAAAACAATTTTTTTTCAAAAAAAGCAAAAAATAAAAACCACA
TGGCACACCGTGTGAAATCACTAGTTCTCAGCAGCAATGGAGGAGTCTTCTTCTGAAGGC
CTGCCCCTTGCCTCTTCTAGAGGGGAGGAGGAAAGGGGATTATTAGCAAGATAAAGGAAG
ACCTGAAAAAACAAGAGAATACTTTACCTTAAAAATTTTTTAAAAAGGAAAAATTAAAAT
ACAAAAGAGAAGACAGAGAGAGGCAAAGAGAGACAGAGAAAATGATAGAGGGTTGCTCTA
CCACTCAAGACTGGGGGCTGTAGGCTGAATTATCAGTAGAAAAATCTTCATTTCTCTTAG
TCCCTGAAATCACTAATTCTCAGCAGCAATGGAGGAGTCTTCTTCTGAAGACCTGCCCCT
TGCTTCTCCACTCAAGATAGGGAGCTGGAGGCTGAACTATCAGTAGAAAATCTTCATTTC
TCCTAGTCCCTGAAATCACTAGTTCTCAGCAGCAGTGGAGGAGTCTTCTCAGCAGGCTGT
GTTCTTACACTGACTGTATGGAAAGAGGAGGCAGAGAAAACCTCCATCATATACACCTCA
GCCTGGATTCTGTGTCTTTTCTGTTTTGTGAATGAGGGGGATGTGAAGAAAAAATAAATA
TGGAGAGTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved