Tupaia_belangeri Locus Mono:168:SNORA2
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:168:SNORA2
Tupaia_belangeri
Mono:168:SNORA2
GeneScaffold_3579
SNORA2
1001..1120
2120
TGGGTAATAGCCTCTTATTAAATATAGGATTAGCAAATATTTTCTGTTATTCTATAAGG
TGCCTTTTTACTTGGTTGTTTGTGTTCATTGATACATAAAAGGTTTTAAGTTTATTGTAG
TTTTGTCCATTTTTTCTTTTGTTGCCCGTTTTGTTTTGTGAGTATGTCATTGTCAAGAAA
TCATTGCCAAGTCCAATGCCATTAAGATTTTCCCTATATTTTCTTCTAGGTGTTTTATAG
TGCTAAGTCTTGTTTATATCTTCAACCCATTCTTATGTAGTTTCAAGATTTTGAATGTGG
ACATTGTTTCCCCAGCACCACTTGTTAAAGAGATCACTCTTTCTCTATTGAATGATCTTG
GCCCACCTATCAAAGATCATTTGACCATATATGGGGGGATTTATTTCTGGACTCTCTATC
TCATTGGTCTATTCATCTGTCTTTATACCAGTACCATGCTGTTTTGATCACGGTAGCTTT
ATCATGTATTTTGAAGTCAAGAAATATGATTATTCAAAATCATTTTGGCTATTCAGGATC
CTTTGAGATTCTGTATGAGGAGCACTGTTTTTAAAATCAGGACAAATACCTACAGTCCTT
TCCCCCATAAACACTAAAAGTAATATTCAAGTAACCACTTTTACTCTCCAAGTCTCATGC
TCTTTCTTCTATATCCCATCACAGCACTCATCACACTACCTTAGATTTGCCTGTTTGCTT
GACTATAAGCTCCTTTTTGAAGTCAGAGCCTAAGTGTGGCTCACTGATCTTCTTCTAGGA
CCAACATAGTGGCTGATTCAGAGAGGACATGTAATATACAATTTCTAATGAATAAACACA
AGTAAAGATAGATGGATGGATGGATGGATGAATGAATGAATGAATGAATGAGACATTTAA
AATACCAGAAGCTGCTGACACGGATGTTGACCTTTAATACAAATCACAAATCATAGAGGA
AGAAGTGTTGACTTACACCAGCCAGCAACAGTATTATTTAGTATACCATAAAAGAACCCT
TGGTTGGTTCAATCAGGGGCCTAAAGGACTGTCTTCCTGTGGTCTGTTGGCTGTCCTGGA
ATCTCAGCAGAGAGTGGCTATTTCATTTGGAAGAAAAAATCCATAGGAAGTAAAAGAATC
ATTGGTCCCTCCCAATGGTTCTTTGATGTGGTATGGGAGCCATACAGAAGTAGCAGAAAA
CCTTCAAGGATGCAGCTCATTTACAGCCCCAGATCCATGAAGTGGAGACTTACCTCTATC
CCTAAGGACTTATATTCAGCCAACACAGCTGAGTTCTTTTTTAACTGATGTTTTTCCAGT
CCTCACTCTGCATCCCAGAATGGTGGAATAATAGAGACTATGACAGTATTAGATTAAGTT
TCCTAAGAGCAGAGTCTAAGGCAGAGATTCTTCTTCAAGTGATTTATTGAGGAACTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATGCTGCTCTTTATTCCCCTCC
CTCATGTGTCTTACAGTGTGAGGGATGCTGGCCTGAAATACCTCTAACTGGGAAGTCCTT
TCAAATGAAGGTACTACCTTGAAATCCAGATGATCTTTTCATCTGATCAACTAGTTACAG
CCACCAGCTTATGGAACATTCTGAGTCTTAAGGTTAATAATCTTTTTTTTAAATTATTTG
TTTTAATTTTATTTATTATTATTATTTATTTTGACCAGAGAGAGACAGAGATAGAGAGAA
AGTGAGAAAGCAACCTGCCAGGTCTGGGGCTCAAACCACAGTAGGCTATGTGGGAGCCCA
GCACCTTAATCACAACTACACCTGCCAGCCCTACAGGCTAACATTCTTTTTTTTTTTTTT
AAATAATTTCTTTTAATTTTTTACTTGTTATTATTAGTTTTTAATTTGACCAGAGAGAGA
GACAGAAAGTGAGAAAGCAAACTGTCAGGTCCAGGACTTGAACTGCAGTTGACCGTATGG
GAGTCCAGTGCCTTAACCAGCACACCACCTGCTGGTCTCTGAGACTAACATTCTAAAGGG
TGCAAGAGTCATTCTGTCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved