Tupaia_belangeri Locus Mono:212:SNORA68
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:212:SNORA68
Tupaia_belangeri
Mono:212:SNORA68
GeneScaffold_6051
SNORA68
1001..1130
2130
TTTCTCAGCAGAGCACTCTTGACCTTTTTTTTTTTTTTATTCCTTAACTTCAACACTTT
ATTTTCTTGTTTTAAATTTTTTTCATATTTTCCTATTCTTTTGACTTTCCCCAAAATTGA
GCTGGGTGATTCTTTGCTGTAAGCGCTGTCCTGTGCATTATATTGATAGGATGTTTCCCA
GAATCCCCGACCTCTACTCACTAGATGCCAACAGCATCCTCTCCCCATTCATGATAACCA
CACGTATCTCCAGATTTTACAAATGTCCCCTGGTATAAGACGGCTCTCTGCTGAGAACTA
CTGCGGTTAGAGATGTGCCATGGAACATAAGTAAGGACAGGATGTAATTCAGATAAACAG
GGAAAGTTGAGGGGGATGAAATCTAGTCTCCTCAGTTTGTAACACCAATGACCAAATAAT
CTTCCCTAAATTTTGGCATAAGCTCAGTATTCCCACTGTCTCAGAATTTCTCATTTTAAT
TGATGTGGTAGACATAAACAGCAATATTTGCTGACCTCTGGGAAGCACTCCTCGTGGGAG
AGTGTCACTTGCTTTCTTCTGAGACATAAGCTTCTAGTCTTTTATTGGCTCCAAATGTTC
CATTTAAAAATTTTGCCCTTGGGGCCAGCAGATGGCATAATGGTTACGTTGCTGGACTCC
CAAATAGCCTACTGTGGTTCAAGTCCCTGACCCGTGCTTAAAACTCATGCCGGGCACATG
TGCATGCATGCCCAAATCCCAAAGAGAACAGAGAAGAGATTGTGGAATGGCCTCAATGGA
TGGTGATTTCTTGTTTTCTGTCTCTGGCAAGCGCACACATCCTATAGCAAAAATCTCTCT
CTAAAAATATAAATAAATAAATGAATGAATAAAGATATGGTCCTTAAACATAAACCTTCC
CATTCAAGTATATTTAAATAATTAAAATATATAATCAGCACTGTCTTTATTCAAGGGAAC
AACAATCTAATATGGAATCACTTATTAATATCATACCTATATTCTCTCCTCAACCCAAGA
GTCACTGTTGGTCATTGCAGCAGTTTAAACAGAGGTGCAGACAGCAAGTGGATTTCGTCA
CCTTTGGGGAGCTGTCGGCTCTGGCTGGAACCCCTGGGCAGCTCCTGGGCCTGGCGGGTA
TGCCAGCTCATCCCTGTCCGTGTGTCAACTGCCTCACCCAAATGCTCTTTCTGCAAATGA
AGACAAGAGCGCCCAGCTCCACGCCGGTGCCCACTCCATCCAGATCATGAAGCTGGAGGA
AACTGGGGCCCAGCAGTCCCTGCCAGCCACCTGTCAAGCAGTTCCAAGACTCCAAGATCA
AGTTCTCTTTGTCCCACTGGGTTCTGCATCCGCAGCATAAGCCATACTTCCCCACCATGA
GGCCCAGTGCCTTCTTCTAGGCTCAGGGTCTCCCACCCAGGGTGGCCAAATAAACTCAGA
GCTGCGGAAAAATAAAATAACTGAATTTGGGTGAGCCCGTGGTGTGGTGGGTAAGGTGGC
TGGATCCCACATGGCTGACTGTGGTTCAAGACCAGACCTGGTGGCTCAAGAAATATGCCA
GGTGTATGTGTATGTGTGCCCAAAATCCTGGAAGGAGGGAGAGATGGAGGAGAGGGGATT
GCAGTGTGATCATTCTCCATGGGAGATGCTTTCTCAGTTTCTCTCTTCTCTCTGTCTCTT
GCCAGTGAATACATATACACCCTGGACAAATTTTAAAAATAAATAGCTGATTAAAAAAAA
AAAAATCAAACCTAAATTCAGTAATTTTGCTTCTTGGACATTTAGTCCAGAATAAATTAT
GAGTAATATTCAATATATGAATCAAACTGGGGATTTCAAAATATTTAAAAAATAATATCA
CAACTCAACAAGAAAATAAACAACTTGGTTAAAAAATTGTACAANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTAGTACGGTGATTCTGCAAAATATTAAAAATAGAAC
TATCACATGATCCAGCAATTCTACTTTTGTTATATACACAAAAGAGTTGAAAACAGGAAC
TTACAGAAATACCTGTACGCCCACGTCCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved