Tupaia_belangeri Locus Poly:0:SNORD50
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:0:SNORD50
Tupaia_belangeri
Poly:0:SNORD50
scaffold_76997
SNORD50, SNORD50
1001..1070, 1277..1348
2348
GCAGGATAAGGTTGACCGCTTCAGTGCTGTGAAGCAGTCTGAGGTTTGGGCTTAGAGTG
CTTAGTGCTGGAAGTTTGAACGTGAGAAGTACAGCTGGACCGACACGTGGCCTGCGCTTT
TTGTCTTGGTGGCCACAGGCGTCGAACTTGGGGAAGAGGAGACTGCCCATCTGCCTCCGG
CGCCGCGTGCAGACGTGTTGCTGACCTCTCTCTTGCTGCGAGCTGGGGCTGAGGGTCGGC
GAAAAAAACCACTTAGGGGATTTAGGGTTGAGGTTAGTTTAAGAGCAAAGGGCATTTCCT
AACATGGCGAATGTACTCCGGTTGCCAGACTTTATTATTTCAAAATGGGCGACCTCGGCG
CTGCGTTCGACTGAGGTGTCTTGTTGGGTGTTAGAACGTTTTGTGTGTATCTCGGATCAA
CGGCGAGGAAGGGTTTAGTGAAGAAATACCTTGAGCTGTCATTTCTGTAAGAACGCTTAA
TCTTCAATTTACCAATCCCTCACAGGAACGATGGCGCTGTCTTCCAGTGTTATGTGGAAA
CGGTTACTTGAAGATACTAAGGTAAGGATTGTTGAGCTTAGTTTTGTTTCAGAATAAAGG
AGTAAACCTGTTGATACACAATAATAGAAAATGATAAAACATCTGAATTTGTCTTGTATT
AGATATACAAGAAGATTCCAAAATGTGTGGAAGAATATTCATTAGAAAGTCACTTTAAAA
CCTGACAGTTTTACCAGGTATGTCTTTGGTAACAGTATTTTTATGACTGAACATAAGATC
ACACATACACTAAATAGAATTTTTTTGTCCTTGAATAGTGTCCTAAGTGTTGAATGAAAC
TAGATGCCACTGACTAGCAGATTAACAATGAGGTAAGTTGTGTGGCTTACAAGTTCTGTA
TTCTAATATGGTCTGCCTTTTTAATTTACTTTAGTATGGTACATAAGCACTGAAATACAG
TGACATATACATAGTATATGCATGTAAGATAGGATTGGTCTAATAAATGATGAAACCTAT
CCCGAAACTGAATACCTGAAGAAAAACCTGTACGGATTCGGCTTCTGAAATCAGACCAAT
ATGCAGAAGTAAAATGAATTTTTGTTACAGATTTTTAAGAGTTCACATGACTAGGAGGGT
TTTTTTGTTAATTTTCTACCAACAGTGGGGATCACTACTTGTCAGAGGAGGCCCTCTCTG
AAGTTTAAAGGAGCAACAATTTCTGTGAGTCAAGTCTTTTATTTTTTGTGAAGTAATAGA
CAATGTGTCCTTGGTCTTACCTATGATGATCCTATCCCGAACCTGAATTTCTGTTGAAAA
AAATAAAATACGGATCTGGCTTCTGAGATAAGACAATTAGAGGACAGTACTTTTATTTAA
TGCCTTTAAATAAGCTCTTATAATGTTGGTAGTCTTGTAAATCTCATGTTTTCTCTTTCC
TAGGGCTACCACGAGGTTTGTCTTATGAAAATGAAAAGCTGGTGATAAAAATATCCTGTT
GTATGGGCATCATGAAAAAAAGTTTAGTTGGATTGTATATTTTGTTGATGACGAAACAGT
ATTTTGTTTTATGAAAAATTATTTTCCTTTCGACTAACCAGCCTTGTATAAACAGCTTAT
TCTGAATGAGTCTCATTAGTCTCAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAGAAAAAGATACAGAGCCCATTACATTGTCCAAGATACTAAATTTCTGGATT
GATGTAGATGGGTGTTAAAATGTTTAACAGAAAGGGCAATAAAAAGGGAAAATAATTCCC
AGACCTTAAAAGATTACTAGCCCAAATTATGGAGTATATAATCTTTACTAATTTAGGGGA
TGTGGAGTATTGGAACTAGGAAATGGAATACCAAATAATTTATTTTTTATTTATTTTTTT
TTTTTTTTGGAGAGGTTTTTCGCTATAGGGCACTTGCACTCACCAGACAGACAGAAAGCG
AGAAATCACCCCCCAGGGGGGATGGCCACGCTACAATCCCTTCTCCATTCTCCTCTCGGG
ATCTTGGGCACGCACGTACACGCGCCCGGCTTGAGTTTTAAGCCACTGGGTTTGGGACGC
GAACCGCGGTCGACTACATGGGAGTCCAGCGACATAGCCATTATGCTAACTGCTGGTTCC
CACCTTTAAAATTTTAATGGATTTTTTTTCTTTGAGAGTCCAGTGACATAGCCATTACAC
TAACTGCTGGTTCCCAAAATTTTTTAGTGGAATTTTGACTTTGGCCATGGGACCTTTAGT
GCAGTAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved