Tupaia_belangeri Locus Mono:47:SNORD116
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:47:SNORD116
Tupaia_belangeri
Mono:47:SNORD116
scaffold_39911
SNORD116
1001..1080
1362
TTGCTTCTCTCCCGGGGTTGCGCGACGGAAGAGACCTTGGATGTGACATCAGCTGCCCG
TTCTGCGAGCCACTGGAAAGGTCCACAAGGTAAGCGTCTCGTTCGGGGTTGACTCGCACC
GGGCAGGTTGGGGTACTCCACGCCCAGGGAGACTTGGATGCCGCAGTGTGTTGCTGCTCC
CTAGGAGTCGTTGGCCTTTGTCTTTCCATCCCAGGCGACCGGAGGAGAGGGTGCCGTTTG
GGGCTCAGCCCTCACACCTCAGGTCCCCGGTCAATGTGTGGCTGGATCGATGATGACTTA
AAAAAAAAATAAAGAAACCTTGGAAATCTGAACAAAATGAGTGACTACCCTGAGCTGAGG
TCCAGCACACGAACCCGGGTAGACGCACGTCGTACTGAAGGGGATTCTCAGGTCGGCAGT
TGTAGACTCGAGGCCCCGGGTGATCAGAGCCAAACACCGTGACTTGGGTGTGTGGCTGGC
AATTGCTGAGAGGTTTAGCAATACCTGGGAAACTGTTCTGTGGCTGGCCAGCGTTCCACC
GGTGTTCCCGCCTCCGTCCCTAGATAACGAGGGGCCTGAGAAATGGGCACGTGTGTGGGG
TGCCCAGGGGCCCCATTCCGTGCGCCCTAGAGCCTCAGGCCACGGCATCTAAGTGCAGAG
TGCACGCCGTGGAGGCCATCTCTCCCGCAGAGGAGACCAGATGGCCTCCGGTGCCCCCAA
AGCGTGGGATTTCACTGGTAATGATGAACGGGTGCCCGAAAGATATCGGCATCGCTGGGA
TGCTGCCCTCAGCAAACGCGTAGGGAACCTTCCCGTTACTCTGGAAGTTCTCTCCACGGG
CAGAGAACCCGTGAGCATTTGGGGATGAGTAGCTCCCATCGAAGCCAAAACATGTTAGCC
AATGAGACCGCCTCACACTGTGCCGTGGCGAACCCAGTGCTCACTTGGATGGAGCAGGTC
TCTGTGGAACAGTACCGAGAGCTGACCTTGTCTGTCACCGCCGCTTTTTGCTCAGAATCA
TCCGTTTTTGGGGGGTTTTTGTTTGTTTGTTAGTTAATCAATTAATCAATTAATTAATTG
ATTGATTAAGCAATATATTCATTTATTTTTCCGGGGAACGACATTTGAGGCTGCAGCCAT
GGGTTTGATCGGTGTGGGGAGTAAGCAGCAGGAGGGCTATGCCATTCAGAGAAACCCGTC
CTGTCCAGTAGTGTAAGAGATGAAGGCGATTCTGAGGGCGTGTGCACGGTGACAGTGAGC
ATGTAGTGTGATTTTTCCACCGTGACGGACACCTCCGTCTTGCCTCGCGCATTGTCGCCT
CACCGCTTTCTTCCTTCTATTTCCTCTAAAGCCTCACCGTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved