Tupaia_belangeri Locus Mono:202:SNORD65
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:202:SNORD65
Tupaia_belangeri
Mono:202:SNORD65
GeneScaffold_189
SNORD65
1001..1073
2073
GGGGAGAGGTTTTCACTATAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCCAGACCTGATAGCTTACTTTCTCACTTTCCCTCTCTCTCATTCTCTGTGTCTCTC
TCTGATTAAATTAAAATAAATGAATGAATAAATAAAATTAAATAATTAAAAAACCCTACT
ACTATGCTTAGCATGCTAATTAACTTTTTTTTCATAATAATGAAGATTTAATAAATTTGG
GAAAATGACTCTAAAGGTTCATCCCAAAGTTTGTGTCTTAAAAGTATCTCCTTTATATTT
TATATTTTCTTGGGGGTTTATACTTCAACTTTTGGTGCAATGTTTTCCTATAATATTATA
AATTATTGGGAACCAGCAGTTAGTGTAATGGCTATGTCGCTGGACTCCCACGTAGTCAAC
CGCGGTTCGCATCCCGGACCTGGTGGTTTAAAACTCACACCGGGCGCTTGTGCGTGCGTG
CGTGCCCAAGATCCCGAGAGGAGAAAGGAGGAGAAGGGATTGCGGCGTGACCATCTCCCC
TGGGGGGTGATTTCTCGCTTTCTGTCTCTCTGTCTCTCTCTGTCTGTCTGGCGAGTGCAC
ACGCCCTATAGTGAAAACCTCTCAAAAAAAAAATTATAAATTATTTGAAAAGGCTTAGAA
TATTACTTAACAATGTGAACAGAAAAGAAGCACATTTAGGGCTTCAAAGTTTAATCTCTT
CAATCTATGCAAAGACAGTTTTGTTTCAGGGTTTTTTTTTTTTAAGTATTTATTATTTAA
CTTTATTTATCATTCTTCTTATTCATTTTGACCAGAAGGAGCAGAGAGAAAGAAAGCAGC
ACAAATCTTGGACTGGAACCACAGTTGGCCATGTGGGAGTCTATACCTTAACTACCACAC
CCCCTGCTGGCCCTTCCAGTTGGGTTTAAAGGTGAATGCTCAATTGATAAAGACACCCAA
AATAGCTGGAATTACTGGCAGATTAAGTAGTGGTGAACCTGTGGTTTTCTGAAGATGAAA
AAAAGGTGAATGCTAAAGACCAATAATTCATTAGAGTCAGACTGTGTCTCAAAGTGAAAT
GGATATGAAGGTAACCAAAAGAGTTCATTTCTTACCACCTGCTCCTTCCAAAATGCCCCG
GACTACTGCCTGTACACCACTGGGTCTCATTAACCTTTCTGAGAGGAGTTGCCCACACAG
ACGTCGAAGCCAAGCTGGGGTCCGACACCTAAGCTGTGTCTTCACATCTGCACAAGACTG
AAAACACAAGAAGGTATGAATTCTGAATATCAATGTAGTAGATATGACATGCAGACATTA
TTTTCTCAAAAAGCACAAGTCATACTGACAATTAACACTTTGCTATACTAACTTCAAAAG
GGCAAAAAAAAAAAAAAGGCAATGTTTTTTCCTAAAACAAACAAACAAACAAACCACCTT
TGCTAAACCTTCTTCAGCTGTACTTTTTTTTTTTTTTTAACTTGTTAGAGGGCATGTGTA
ATCGCTGAAGAGAGACAGAGAGAGAGGGGGAGCAAGAGAATGAAAAAGCACAACCTGGGG
GATGGCCATCCACAATCCCTTGTCGACAACTTCATTCTTCTCTGGGAATTTTGAGCATGC
ACACACACTTGCCTGGGGTATTTTTCAAGTTGCTGGATCTAGGACTCAAATGGCAGAGTC
CACCATGTGGGATCTAATGCCTTAACCAACTTGCCACCTGCTGGCCTCAGCATTACTTTT
AAGGGAGTAGAATTAAAGTCAGTGAAATTTCAAATCAAAAAAGAGACATAGTGAATAAAC
AAAGATATTGAGAACACAAAATTAATGCAACCAATCTTTGAATATAGTCCATCTAATCAA
ATCTAGCTTCAAAAGAAGAGTCTTATAAATATAATTCACCACTAAGAGGACCGTTTGCAA
CAGTGAGGCAGTACTCCAGACCTTGCCTCTGTGGTCTTAGCTCCTCTGATTCCGGTCATA
TGGCACTTTGAAGAAAGGGTGGGAATTCAGGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved