Tupaia_belangeri Locus Poly:4:SNORD116
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:4:SNORD116
Tupaia_belangeri
Poly:4:SNORD116
scaffold_9992
SNORD116, SNORD116
1001..1092, 3511..3602
4602
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTAGAGTCTGTCTCTCTTCATTACCTGTATGCCCTGGGAAGAAGCATA
TATCCTCATGTTATCGTGTGGTATCAGTTCAGGCAGTAGCTGTTAAACAGGAACTCTTTT
TGGCTTTGGGGTCCTGCAGAGGTAAAAGGGTACATTCTTCTGTTGGAAGTATTAGTATTT
CACAGGGGGATGGCTGGGCATAATAGGAGTAACATTGTAGCTCATTATGGTGTTGAGGTA
CACAGAGTCCTCTTCAGGATGAGACACACACAACACAGTTATTACCATATTACATGTGTA
TGTATAAATACACATACATAGAGACACATACACAGAACCCTCCTGCCCCATGTTACGGTT
ATCCACCAAGTTCAATGTGGACCTAGAGTTAGGCAGATAATAGAGGTAAATGAGAAATAA
ATGCAAAGGGTACCCTGTGGGCAACAGTGGCCTGCACATGTGGTTCTGTGTACCTGAGTC
TGTTTCTCAAGCTCCTGTGTCACGTTTCTCCCCTACTCAGGGGGAGGTGCTGAAGAAGGC
TAACTGCATACTGAGGGAAGACATCTGTCTCTTGTGAGGACTGGAGGTGCTTGGAAATCC
TGTGATGAGTGTGGCATGCATCGTGCCGACTGCAAGTGGGTCCCTCTGGATGGTAATTAT
GTCTTTGGCCAACATGTTGATGTTGTCTTCACTATGTGGTAGACGAGAAGGACCTAGGTG
TCCACTAACCATGAATGGCATGCCAAATTTTACTTTTCAACTCAACAGTCTGCTTAGGTG
CCAGGCTCTTGATTGATCAGCATACCGAAGGTCCTTGAGGTCATTGGTCTGCCTGGTACC
TGGTCCACAGTACTCAACTTGTAGCCTCTTAGAATGTGCTTGGATCGATGATGATTCTTC
TATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGACTCACTACGTCTCTCTCATC
GCAACTGAGGTCAGCACATGCTTTCAGTTGGGACTGTAGAGTCAGGTCGCCTCCACTGAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAACATGTCTCAACCCAAA
AGAGAAGAAGACTTTGCCCACTGGGCACCTCTAACAAAAGGGGACGTGGACATAAGGAAA
CTGAGAGGGCTGCCCATGGCCCTCAGTCTGGGCTTGCAGCCTGGGAGCACAGAACGAGCA
TGGACCTCCATGGTAGAACTCAGCAGTCATTGAGGCCCCCATGGCCAAGTGCGTAAGTTG
TACACGTCTTTCTTAGCAACTTTTTCCTAACAAAAGCTCTCTGAAACACAGTTCACCAGG
AACAGGAAAAATATTTCTCAGTGTGGATGAAGCCTGGCCATCACTGTTGCCAATGTGAGC
CGCTCGCAGGCATGAAGTAGACAACCATTCTATCCCATGACCCTGCCATGAGTACCTGAA
CTGCATGGACACTCACTCTGGGGGTTCCATGAACAAACACTGAAGCCTTATTTAGAAACA
CACTGTTGGACTCATAACTGCCTAGACACACTCACTGAAGACCCAAGTCACGGTTAGAAA
ACACCAAGACAATATGTGGCATGTGTGGCCTCTTAGACTTAGTCTCAAGGCTCCATTCCT
GCCTAGGCCATTGGACCCTCGACTCCTGGACCCCGAGTCCTTATGTATGAGAAAAGACAT
GGTGGGCCATCTCATGATGGGCGTCTGCATGTGAGGCAAACCAAAAGTCACTACCTACCA
TGTCCTTAATGCCTATTCATTCTACCTACCTCATTTTCATTGGCACTTACATCTCCTCAC
CAAACTCGGCAGCAAGTACTAGGGTCTGGCTAAAGGCTGAAACCTCTATCCTCACCAGGG
AAAGAAGGGCCTGATCTTCTGCTCAAAGACATAGGCCATGAGGGACTCTACCCAAAGGTC
CAAAATGCCAACAAAGAACACTGTTAGGACATCAACAAGCCTAGGGCACATCTGAACACT
CACCTAGTCCTACCACCCATTGTGTTTGAAAACCATGCAGTTTCTTTTCTCTTTTTTTTT
CATCAGGTTTTTTACATAGGGCAATTGTGTTTCCTGGAGACGGAGAGAGAAAGAGAAAGT
GAGAAATCTATCCACACCGTTTCTGCTCCTCCATTTTCCTCTTGGGAGTTTTAACATGTA
TGCACATGCATCTGGCATGATTTTTAATGTACAGAGTCTGGGACTCAGGCTGTGGTCAGC
CATGTGGGAGTCCAGCACCTTATCCACCACACCACTCGCTGACCCTTCCACCCATTTTCT
TAGAATGTCTCATCGGGTTCTTGAGGACCAGTGAAATTACTGGATTGAAATTAGTGGAGT
GAGTCTTGAAGTATGATGCAAATTGAAAGGGGCTTCTCGTGCCTTTGGGCCAGTGTTTTA
GACAGACACGCGGACTCTCGTGGACATTTCCAGTGCTGGCGGTCTATGTGTGTGCTCTGC
CTCAGACAGCACCCACAGACAGCAGGTCTGCTCTGCCTTCAGAGCCACTGCAAGTAAAGA
GTGTGTGCATCCATGTGTGTGTGTGCTCTTAGACATGCAAACGCTAGTTGATTTTGGAAA
CCCACAGATGTGAGAAGTCACGTCCTTTTCTGGAAGTCTCTCTTGTTCTGCAGGAGGATG
ACAGGGCCTGAGAGAAAATACATAGTGGGAGCTCCTGAAGGTCCTGACATACCCACATGC
CCTCCCACGAGTGAAGCACGCACAAAGTCACCACCACAAACTCACATGATCACGCATGCA
CACGCACACACACACACACACACACACACAGCACTACCCTGAAACCTGGATACAGGCATC
CAGAAAGCTCAGTGGGGATCCTGGTAACCCAGGTAACAGCAGTAAATAGGCAGATGTGCT
CGGCAGCCTGTGGGGAACAGTAGCATGCTTGTGGTTTGATGTGAACGTCGGTTCATTTCT
TAACCACACACATGCTTTCTCTACCTTATTCAGGGGAGAGCCGTGATATGTGTGTCGTGC
ATGCAGATGGAAGAGCTTTGTTTACTGGCAGGACTGGAGGTGCTTGGCAGTTGAGTGAGG
AGTGTGGCTTGGATGTAGCTGACAAGTGGTTTGCTCTCGAAGGTAAGCCTGACTTTGCCC
TCCGTGTTGCTATTGTCTTTAGCATGCGGTGGACCTGGAAGGACCTTCGTGTCCACAGGC
CTTTAATGGCATACCAAATTTCACTTAACGCATGGACCATCTGTTCCTGCTGCTGGGCTC
TGAATTGTACAGGGTCCTGATGGTCCTTGAGGTTATTGGTCTGGCCAGTGTCCCACCTGT
GGTGCTCAACTTTCAGCCATTAAATGTGTTCGGATCGATGATGACTCCCCAGAAAACATT
CCTTGGAAAATCTGAACAAAATGAGTGAAAACTCACAACCGTCTCTCATTGGAACTGAGG
TCTAGCACGTTCCCCTAGCATGGTCACCTTCCACTGGTGTCCACAGTCACTCTACTAACC
AGGGCATCAAACAATGCAAGTATGCCGTTGTGGGCCATGGAGACATATCCTCCATGAGGT
GTGCATGGGTCGCAAATTCCTGGTGGACTGGACCCTCTCTGGTGGCAGAGTGCCCATGCA
GACAGGCGTCCATGCTGCAGAAGCAGATGAGTGTTTGGGGCTGGCCTGTGCGTGGTCCAG
TCTTGTCAGAATTCTATGTTGCTGATATGGGCCTGCAGATCGAGTCCCTCATGTCCATGT
TCTCGAACAGAGGGCCAGGCCTCCTTTTCCTGGTGACACAGGGCCTGCCCTTTGCAGACC
TAGCACTTGCTCCGAGTTTGGTGAGGAGGCAAGTGCCACTGGAAATGAGGTACACTGAGA
ACAGGCATCAGGGAGGTGGTGGTGGTAACTCTTGGTTTGCACCTCACACGAATGTCTGTC
ATGAGTCAGCCCACCATACCCTTGGTCACACAGTGGCCTACAGTGTCCAGACTTTGAGGG
TCATCCATGGACCAGGCAGAAATGGGACCCTGAGGAAGAAATCCAAGATGGCATATGTGA
CTTACCATACACGAATTGTTTTGGCGTTTTTTTATGCATTTCCTAGGTCTTCAGTGGATG
CCCCTAGGTGGTTATAGGAATAACAAAGTGTGGTCTCAAGTGAAAGGCCAGTAATGACGT
ACTCAATTAAATTCCTTGATTGAAGTATTTGGAAACTCCCAGATTACGCCCCCGTGCACT
TCAGATACCTGGGGCAGGGTCATGGGATACAATGTTTGTCACTTCCTGCTAGTAAATGAC
CTACTGGGGCTAGAAAAGACCTTTGCCTTAGGCATACTTGGCCATGTGGGACTGTGTGAA
ACTTGAGCTTTTACATGGCTGTCCATCCTTATTCCATGTCCCCAGTCTGCAATTTCAGGC
CCAATGTCACAGACAGGCTTTCCTAGCTTGTTGATATCCATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved