Tupaia_belangeri Locus Mono:146:SNORA73
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:146:SNORA73
Tupaia_belangeri
Mono:146:SNORA73
GeneScaffold_5749
SNORA73
1001..1202
2202
ACTATGCAGAGACCAGGAGATGACATAATGGTTACGTTACTGGATTCCCATGTAGTCGA
CCGAGTCCTGGACTCAGGTGCTTAAAATTCATGCCAAGTACATGTATGTGTGTGTCCAAA
ATCCCGAGAGGAAAATGGAGAAGGGATTGTGGTATGGCCATCCCTCCTGGGTGTGATTTC
TTGTTTTCTGTCTCTCCAGCAAGTGTCTAAGCACATGCAACCTAAGGCAAGCACCTCTCA
AAAAAAAAAAAAAAAAAAAGAGAGAGAGAGAGAGACTATGCAGTTGGTTTTGTATTCTTT
TAATAATGTTGTTTAACAAGAAATACATCTAAAACAAGATGCTCCTAAAAGGGTTGAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGGCAACCTTCCCCTGTCTG
CCTTGAGCTTTCTCCCCCGAGGGCCCAGGACACAGACCCTCTACTTCCCAGTCCAGACAG
GTCCTGGCGGCCAGGGGAGCCCCAGTACGTGCTGAGTCCCCACGCCAGGGCAGAGTGGGA
CCTCAGGGCGAGTGTCATCCCCTGACTTCTCTCAGCACACTTCTCCATTTCTAATACGCC
CTTCCTGTACCCTGCGGGCAGCCTCCTCTTACTCCCAAATCTGTCCCCATCTAACTGTTC
TAAGGGCTCTGAGAATGAGTACATCAAGTCTGAGCAAGGTGTTTCCAGCTTTCACGAGTG
GGGTTTTGGGGTATCAGTAATTGGGAACTGTTGAATCAAACCTCTGGATGGGGACAAGGA
CTTCTGGAATCCTCTCTCTATTCGAGCCTCTTTGCTCCCTTGTCCTCTAGCCAGGTGTGC
CTAGTGTTTATCTCTCTGTGACAACTGTAGGATTTATGGGGAGAGGAGGGAAGAAGGAAT
GTTTGCTAATAAAAATTTACTGGTAAAGAAACGTGCACTTGCCAGTGTGGATACCCCTGG
GAGGTCACACTCCTCGGGGCTCTGCCCAGGTGGCTAAGGGAGCAGAGAGCTTTGCCCCAT
GATGTACACTCCCTTCCCACAACGTGGAGATGAACTGGGCCTCTGTCTGCTCCTGCATAT
TTCCACAGCTTCTCAGAGTCTTGCGGACAATGACCAAGGAGACAAGCCATGCAGTAAACA
TCCCTCTAAAGTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved