Tupaia_belangeri Locus Mono:171:SNORD22
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:171:SNORD22
Tupaia_belangeri
Mono:171:SNORD22
GeneScaffold_140
SNORD22
1001..1113
2113
CCCAGCTGGGCTACAGGGAATGGCTTCAAACTCTCAGGGCCTTCAGGTTGCACCAGAGA
GTCACCCTGGCATGCAGCATCAATTGCCCCAGGAACCTTCCCTGCGATGGTTAAGATTCC
AGAAATGGAAACCGAGTCACAAAAAGCCAACATTCTCAACATTTTAATGATGCTGAGGGA
CTGACCAAGTGTTTCCCCGCCAGCCTCACCTTAGAGTCTTGCAGACTGGCAGTCACCCTA
ACGGTATTTAGGTGACGGTCTGATGCCCAGTAATTTCACCTGATAGAGCTAGTTTCTAGG
GATGAGAGTGTCCAAGAAAAAAAGGATAGAAAGTCTGCATTACTCAGCATTCTCGTGTGA
AGAAGGGGAGTCTAGATGTTTCTTGGCTCATGTACCAAAGTATGACGCAGGAACCCAGGG
GGCCCAGGGGCTGCAGCCCCCCCCCCACCCCCGCCAGCCAATTGGCTGAGTCCTGGGCGT
TCACCATGAAGACTTCCTCCGGAGATCCGGGACTGGTGAGGGGGGCCCCAGGTGACTATG
TCAGGCGCTTTCCCCAGCGTGGACGTGGGTGGACAACACCCCGCCACCATTTCGGGAAGG
GGTGTGGGGGTGCTGGGTGCAGAACGTTGTCGGATTTCCTTTGCACTCCACATCTCAACT
TCCAGTCTTTCCGAGGTGGTCCTGCAGCCTGCACCCGCCTCAGTCCGCGCAGGCGCACCG
GGCTCAGCCTACTTCCTGCTTCTCAGGGTCTCCCCTCATCTGACTGTCCTTCCCAGTCCC
ACAGCCTTCTCCCCGCTCCGCCACCCTCTATCCCTCCCCGGGCAGCCTGTGCTCACCTGT
GCCTGAAGCAGCAGCAGCACCCCCCAGCAGCACAGGGCCAGAGAGCAGCTCCATGGCACC
CTGAGCTCCTGCCCCTAGCACCCGGGATTATAAAGGGTTAAGAAGGGGCGTGTCCTCCCC
TTTCCCTGGGCTCTCACCAGCTGTTGTCAGGGCAACACAGTTTCTAAACAGGAGTTCAGA
TCTTCCTGTCTTAGCCACAGAGTCTGCAAGGGTGAACCCACTGGGGCTGGTTCTGGGAGT
AGAGGAAAGTTCCAGAGAGAAGTGTCTCTGGGTTCATAAGGATTTCTATAGGAGGGAAAT
CACTTGTTAAAGCATTAAAAGGAAAGAACAACATGCTTACAAATGGAATCGAAATCGTGG
ACGTGGAAAAGGGCATTTTCAGGTTTCAAACAGCTTATATTTGTTCAGCATATTGCCATT
TAATCCCAAACTCCCTGCCGCCGCTGACTGGGCTCTCCCTAACTTCACATGTTCGCCATT
TTCCACTGTAGCCACCTGTTCAGTTCCTACGGATAGAAATAAAATATCTTAGGGCCGGCA
GGTGGCATGGTGGTTAAGGGCGCTGAACTCCCACTTGGCCTACTGTGGTTCAAGTCTCAG
ACCTGGCGGCTTACTTTCTCACTTCTTCTCTATCACTCTGTCCCTCTCTGCTAAAATTAA
AAATAAATAAATAAATAAACTTATTTGAAAAAAAGGAAATAAAATATCTCTTCATTTTAA
AAAAATAGAGCTACAGCTAAGCCTTGGATGGGGCCCATACGCGTGTGAGGAGCACCCGCT
CCCCTGCCCATCTGTGTGCCGCCTCGCTGGCCTGTACCCCGAAGTCTGCAGCCCCATCAG
TCCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAAATAATTAGGC
AGTCTAATTAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved