Tupaia_belangeri Locus Mono:48:SNORD88
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:48:SNORD88
Tupaia_belangeri
Mono:48:SNORD88
scaffold_139286
SNORD88
1001..1073
2073
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCATGGTCAAAATCCTGAGAGGAGAATGGAGGAGAAGGGATTGTGGTGTGGCCATC
ACCCCTGAGGGTGGTGGGTGGGGTTATTTCTTGCTTTCTGTCTCTCTGGTGAGCACAGAG
TTCCGAGATTTGAACCACGGTTGTCTATGTGGGAATTCAGACATATAACCATTACACCAT
CTGCTGGTCCCAGAAATTGAAATACTCTTAGCCAGACATGACTATGAAAAGGGTCGTACT
GTTCTGAAGGGGTATCCTTTCCTTCTGACATATTAATAGATTTGTTTGTCCTGTTCTGTG
CTTTCTGCATGACCATTTGTATTGTGAAGCATCTTTTGATTATTCAAATTACTTTAGGTG
GAGCTCCCTATAACCTATAACCATATTTTAGAGAAAAAAATATACCCCTACAATGTCTAG
CACTGGGCTCTGACCACCCTGAGAACATATTACCCCCCGGGGGAGTTTGAGGGGCCCCAG
CTCTGAGGATGTGCTGGGGTGGGGCTGTGACCATTTACCCTGCCTGGTGTCTCCTCTCTG
TCCTCACTGCTTGTTCCCTGCAAAGCTTGGGGCAGCTGCTCTGCCTATACCACATCTTGG
CCATCGTGGAGTGTCATACAGCGCCCCAGTGAGCTCATGGTCACCAGCAGGGACCTGTAC
CTGAACTCTGGGGAGCTGCCATGACTGCCAACCTGACCCATGATGCCATCACTGTGAGGC
CTTGCAAGGCAGCTCCCCTGAACTACTTCCTCCACTCCAATGACATGCCTTCACCCAGGG
CCTACAGTGATGCCTGCTGGCAGGGATGCTCTTGGAGCTCTGGCCCTGGCTGGCCTGCCT
GCAGGGCATGGCAGAGTGGGAATCCTTAACAAGATCTAGGCCACTGCTAGGTCTGCCCTG
ATGCTGAGGGTGTGCTGGAGCCTGGTCCATATGCAGGAATCTTATAGGCTGGCTCCTCAT
CCAATATGTATCCAGGGAGAAGGTAGGCAGAGCCTCCAAAGTGCCCTGGAGCTCCACATC
AGGGAGGCCTTGGCAGCACCTGGTCGTGGCTCCTGTGGAGGACAGCTAGGCCTGGGGAGT
GCTGGAGTCTGAGGAGTGCACTCTTCTGTCTGCTCAGGGGAGCTGGGCCGGTGTCAAGTT
CTGACCAGCACCTTCCCATAGCCTCTCCAGCATCCTATGGGCAACCCATGATGCCAGGTT
CAAGGGCCCCAGACAGAGTGGTGTCCTATCCCCAGACACCCCTCAGGTTCACACACTGGC
TCCTCAGGTGTGAATGTAGCAACAAGGTGGTAGCAGGACACTGACCATCCCTCACCCACA
GGCCCCAGGGAGACCCTGAGGCCCACAATGTGAAAATGCCTTATTTTTGCCCCCTACTAA
AGATTTTTTTGAAATTAAAAAAAAATGCATATACTTTGATTAAAGAAATAAACATCCATG
TGCAGGGACTATATATTAGAGAAACAGAAGTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved